Penstemon ellipticus

Coult. & Fisher · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 593

Data sources9

Biological traits9

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Penstemon ellipticus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 593 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 593 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.67 mg

Seed mass max0.67 mg

Seed mass min0.67 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon ellipticus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218017.1 ↗307 bpCanada · 1995

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Penstemon ellipticus voucher 82191HIM 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon ellipticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-fedorov

CCDB · book-fedorov — Packer 1964

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 593 records

Wild obs. + sensor1 226

Museum / vouchered366

Cultivated / captive1

Range

Area of Occupancy AOO2 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 727≤1 km 132≤10 km 74>10 km 31

964 georeferenced · 262 without coordinates

Open the mapobservation + sensor1 226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 28≤1 km 68≤10 km 51>10 km 4

151 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence366

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	112
Moscow, US	83
Bronx, US	27
Pullman, US	25
University of Lethbridgelocation not on record	23
WTUlocation not on record	23
University of Alberta Museumslocation not on record	19
Bozeman, US	15
Vancouver, CA	9
Victoria, CA	7
Boise, US	4
Corvallis, US	3
Wuzhou, CN	1
Royal Alberta Museumlocation not on record	1
Logan, US	1
Pocatello, US	1
Philadelphia, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Chongqing Museumlocation not on record	1
Université Lavallocation not on record	1
Los Angeles, US	1
University of Guelph, OAC Herbariumlocation not on record	1
Austin, US	1
ASUlocation not on record	1
Cheney, US	1

26 institutions · 364 of 366 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Penstemon ellipticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 14.0–14.0

Seasonal swing summer↔winter24.1 °C

Max temp (day)21.0 °C

Min temp (night)7.60 °C

Precipitation69.4 mm/mo

Air humidity56.3 %

Moisture balance-57.8 mm/mo

Vapour deficit701 Pa

Wind speed2.20 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon ellipticus

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 593 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 593 records