Penstemon deustus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 632

Data sources9

Biological traits85

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Penstemon deustus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources85 traits

Chemical compositionNPASS2 compounds

Occurrence & distributionGBIF1 632 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.61 m

Seed mass0.18 mg

⚠ sources differ — TRY: 0.18 mg · GIFT: 0.656 mg

Seed mass max0.2 mg

Seed mass min0.16 mg

Life cycle & reproduction24

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colouryellow

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life formsubshrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment22

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formSubshrub, Forb/herb

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min14 in

Shape and orientationSemi-Erect

Small grainNo

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min100 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max18 in

Precipitation min10 in

Salinity toleranceLow

Shade toleranceHigh

Soil pH max8 pH

Soil pH min6 pH

Temperature min-33 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

03Chemical composition2 compounds

Compounds documented for Penstemon deustus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Stigmastane steroids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
beta-Sitosterol		present	NPASS
YCZQDKIUGZGCAN-REJZWNMHSA-N		present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon deustus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ531082.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGTGCCGAGGCGCGAGGGTCGCAAGCCCCTCGTGCCGAGGCCCCT …

Penstemon deustus var. suffrutescens internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★trnL-F★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon deustus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · book-fedorov · CCDB · kew

CCDB · book-fedorov — Heitz 1927b

CCDB · book-fedorov — Clausen J. et al. 1940b

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chuang, T. I. & L. R. Heckard. 1992. Chromosome numbers of some North American Scrophulariaceae, mostly Californian. Madroño 39(2): 137–149.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 632 records

Wild obs. + sensor1 466

Museum / vouchered166

Origin

Native6

Range

Area of Occupancy AOO4 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 882≤1 km 114≤10 km 49>10 km 48

1 093 georeferenced · 373 without coordinates

Open the mapobservation + sensor1 466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 5≤1 km 18≤10 km 33>10 km 3

59 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	62
WTUlocation not on record	58
Riverside, US	9
University of Stellenboschlocation not on record	8
Claremont, US	6
Missoula, US	4
Vancouver, CA	3
Bronx, US	3
Logan, US	3
Kew, GB	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Provo, US	1
Wellington, NZ	1
San Diego, US	1
Yellowstone National Park Herbariumlocation not on record	1

15 institutions · 164 of 166 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Penstemon deustus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Growing in rocks

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 7.00–7.00

Seasonal swing summer↔winter25.4 °C

Max temp (day)13.9 °C

Min temp (night)-0.1 °C

Precipitation112 mm/mo

Air humidity52.2 %

Moisture balance-16.4 mm/mo

Vapour deficit485 Pa

Wind speed4.70 m/s

Cloud cover37.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon deustus

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction24

Habitat & environment22

Physiology & chemistry18

Uses & economy13

Other traits4

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 632 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 632 records