Penstemon davidsonii

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records2 954

Data sources11

Biological traits13

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Penstemon davidsonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility2 954 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF2 954 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI484 Mbp

01Narrative

Penstemon davidsonii is a species of penstemon known by the common name Davidson's penstemon, honoring Dr. George Davidson. It is native to North America from the Sierra Nevada Range in California and Nevada through the Coast and Cascade ranges of Oregon and Washington into British Columbia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.309 mg

Seed mass max0.361 mg

Seed mass min0.256 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon davidsonii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG218837.1 ↗320 bpCanada · 1987

ACGT

CCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCATCTC …

Penstemon davidsonii voucher 77774HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Penstemon davidsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size484 110 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon davidsonii0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chambers, K. L., D. Green, S. Potampa & L. McMahan. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18–22.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 954 records

Wild obs. + sensor2 724

Museum / vouchered226

Cultivated / captive3

Fossil1

Origin

Native15

Range

Area of Occupancy AOO5 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 523≤1 km 291≤10 km 159>10 km 79

2 052 georeferenced · 672 without coordinates

Open the mapobservation + sensor2 724

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 6≤1 km 76≤10 km 35>10 km 2

119 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence226

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	30
Arcata, US	19
Claremont, US	16
WTUlocation not on record	15
Angwin, US	13
Fredericton Stock Culture Collectionlocation not on record	12
DOI/NPS, Mount Rainier National Parklocation not on record	11
San Francisco, US	8
Santa Barbara, US	8
Vancouver, CA	7
Tacoma, US	7
Riverside, US	6
Pullman, US	5
Provo, US	5
San Diego, US	5
US	4
Northridge, US	4
ASUlocation not on record	3
Bloomington, US	3
EL PASO, US	2
Denver, US	2
University of Guelph, OAC Herbariumlocation not on record	2
Ashland, US	2
Pacific Lutheran Universitylocation not on record	2
Los Angeles, US	2
Henderson, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Corvallis, US	2
San Luis Obispo, US	2
Moscow, US	2
Oskarshamn, SE	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
Logan, US	1
New Brunswick, US	1
Saint Louis, US	1
Portland, US	1
University of British Columbialocation not on record	1
INFlocation not on record	1
Moscow State Universitylocation not on record	1
Kew, GB	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Cheney, US	1
Flagstaff, US	1
Bangkok, TH	1

46 institutions · 220 of 226 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Penstemon davidsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 0.3–13.2

Seasonal swing summer↔winter24.4 °C

Max temp (day)18.3 °C 4.80–19.5

Min temp (night)6.60 °C -4.50–8.10

Precipitation51.6 mm/mo 27.2–73.8

Air humidity56.8 % 53.0–63.5

Moisture balance-59.6 mm/mo -85.6–22.5

Vapour deficit661 Pa 283–748

Wind speed3.50 m/s 1.80–5.20

Cloud cover37.2 % 35.8–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon davidsonii

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 954 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions32 of 46 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 954 records