Penstemon cyathophorus

Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records139

Data sources6

Biological traits12

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Penstemon cyathophorus's data was compiled from.

GBIFGlobal Biodiversity Information Facility139 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF139 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.13 mg

Seed mass max1.13 mg

Seed mass min1.13 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition7 compounds

Compounds documented for Penstemon cyathophorus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids4

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S)-2-Amino-3-Hydroxybutanedioic Acid	present	NPASS
[(1S,2S,4S,5S,6S,10S)-5-hydroxy-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-2-yl]methyl benzoate	present	LOTUS
Catalpol	present	LOTUS
methyl (1S,4aR,5R,7R,7aR)-4a,5-dihydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,6,7,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	LOTUS
methyl (1S,4aR,5R,7R,7aR)-4a-hydroxy-5-[(2E,6E)-8-hydroxy-2,6-dimethylocta-2,6-dienoyl]oxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,6,7,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	LOTUS
Verbascoside	present	LOTUS
VQTLPSCRBFYDNX-LWMBPPNESA-N	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon cyathophorus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ534936.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGATGCCCCT …

Penstemon cyathophorus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor60

Museum / vouchered79

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 37≤1 km 1≤10 km 1>10 km 4

43 georeferenced · 17 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 13≤1 km 12≤10 km 12>10 km 3

40 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	18
Musee des Dinosaures d'Esperaza (Aude)location not on record	17
Wuzhou, CN	15
Bronx, US	13
Denver, US	4
Pullman, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Lincoln, US	2
University of Stellenboschlocation not on record	1
Grand Junction, US	1
Moscow, US	1
Pomona Collegelocation not on record	1
Provo, US	1
Chapel Hill, US	1

14 institutions · 79 of 79 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)