Penstemon confertus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records2 065

Data sources12

Biological traits93

DNA specimens7

eDNA detections4

Sources12 archives

Databases and archives Penstemon confertus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 065 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources93 traits

Chemical compositionLOTUS · NPASS47 compounds

Occurrence & distributionGBIF2 065 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT1.3 Gbp

01Narrative

Penstemon confertus est une espèce de plantes de la famille des Plantaginacées, originaire d'Amérique du Nord. Elle est connue sous le nom de Yellow Beardtongue en anglais.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.61 m

⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.405 m

Seed mass0.083 mg

Seed mass max0.08 mg

Seed mass min0.07 mg

Life cycle & reproduction25

After harvest regrowth rateRapid

Bloom periodMid Summer

Coppice potentialNo

Flower colouryellow

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endFall

Growth rate USDARapid

Life formperennial

Life spanperennial

Lifespan categoryModerate

Lifespan years8 years

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateNone

Habitat & environment23

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Growth form USDASingle Crown

Hedge toleranceMedium

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza typenon-mycorrhizal

Root depth min6 in

Shape and orientationDecumbent

Small grainNo

Woodinessvariable

Physiology & chemistry20

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceNone

Cold stratification requiredYes

Drought toleranceLow

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min120 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max65 in

Precipitation min15 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceLow

Soil pH max7.5 pH

Soil pH min6 pH

Specific leaf area (SLA)14.8 mm²/mg

Temperature min-23 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound4 628 571 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceNo

Planting density max2 700 per acre

Planting density min1 700 per acre

03Chemical composition47 compounds

Compounds documented for Penstemon confertus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisabolane sesquiterpenoids8

Noreudesmane sesquiterpenoids6

Pyrrolizidine alkaloids5

Iridoids monoterpenoids5

Stigmastane steroids3

Documented compounds47 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(1R,4Z,6R,7S,11S,17R)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadecane-3,8-dione	present	NPASS
(1S,6S,8aS)-8a-(hydroxymethyl)-4-methyl-6-prop-1-en-2-yl-2,3,5,6,7,8-hexahydro-1H-naphthalen-1-ol	present	NPASS
(R)-5,6,7,8-Tetrahydro-3-hydroxy-7-isopropenyl-1-naphthalenecarbaldehyde	present	NPASS
2-Hydroxyplatyphyllide	present	NPASS
2-Propenal, 3-(4-hydroxy-3-methoxyphenyl)-	present	NPASS
4',5-Diformyl-2-methoxydiphenylether	present	NPASS
6beta-Hydroxystigmast-4-en-3-one	present	NPASS
7,7-Dihydroebuloside	present	LOTUS
7-Ketositosterol	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon confertus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220121.1 ↗441 bpCanada · 1991

ACGT

TGCAGAATCCCGTGAAGCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Penstemon confertus voucher CCDB-18342-H8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★trnL-F★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon confertus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 276 290 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon confertus1.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy4× tetraploid · measured

Chromosome records32–322n range32median32mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 326×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Clausen J. et al. 1940b

CCDB · book-fedorov — Keck 1945

CCDB · book-fedorov — Taylor R. L., Brockman 1966

CCDB · book-atlas-flowering-plants — Keck "1945 "

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 162×CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · book-ipcn66 — Taylor & Brockman 1966

CCDB · book-ipcn67-71 — SPELLENBERG, R. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 065 records

Wild obs. + sensor1 720

Museum / vouchered340

Cultivated / captive5

Origin

Introduced4

Range

Area of Occupancy AOO4 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 079≤1 km 158≤10 km 59>10 km 63

1 359 georeferenced · 361 without coordinates

Open the mapobservation + sensor1 720

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 11≤1 km 51≤10 km 62>10 km 5

129 georeferenced · 211 without coordinates

Open the institutions mapphysical evidence340

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	122
Missoula, US	92
University of Lethbridgelocation not on record	34
Victoria, CA	29
Vancouver, CA	18
Wuzhou, CN	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
St. Paul, US	4
Whitehorse, CA	3
Université Lavallocation not on record	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Research Collection of B. A. Bennettlocation not on record	2
Moscow State Universitylocation not on record	2
Millersville, US	1
Turlock, US	1
Pullman, US	1
Saint Louis, US	1
Madison, US	1
Santa Barbara, US	1
Austin, US	1
Research Collection of Jonathan Farrlocation not on record	1

21 institutions · 338 of 340 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Penstemon confertus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C -7.50–10.8

Seasonal swing summer↔winter22.2 °C

Max temp (day)15.8 °C -4.90–17.6

Min temp (night)4.40 °C -10.9–4.40

Precipitation88.5 mm/mo 76.7–138

Air humidity57.5 % 53.5–74.2

Moisture balance-36.5 mm/mo -56.3–98.1

Vapour deficit527 Pa 150–609

Wind speed3.20 m/s 2.20–5.50

Cloud cover38.5 % 34.8–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon confertus

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction25

Habitat & environment23

Physiology & chemistry20

Uses & economy15

Other traits6

Compound class profile5 classes

Documented compounds47 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 065 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 065 records