Penstemon comarrhenus

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records662

Data sources8

Biological traits12

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Penstemon comarrhenus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT875 Mbp

01Narrative

Penstemon comarrhenus (dusty beardtongue or dusty penstemon) is a perennial plant in the plantain family (Plantaginaceae) found in the Colorado Plateau and Canyonlands region of the southwestern United States.Canyon Country Wildflowers, Damian Fagan, 2nd ed., 2012, Morris Bush Publishing, LLC. in cooperation with Canyonlands Natural History Association,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.84 mg

Seed mass max0.84 mg

Seed mass min0.84 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon comarrhenus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ531074.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGACCCCCGTGCCGACGCCCCT …

Penstemon comarrhenus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Penstemon comarrhenus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size875 310 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon comarrhenus0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type662 records

Wild obs. + sensor233

Museum / vouchered429

Range

Area of Occupancy AOO1 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 125≤1 km 24≤10 km 10>10 km 14

173 georeferenced · 60 without coordinates

Open the mapobservation + sensor233

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 26≤1 km 44≤10 km 70>10 km 12

152 georeferenced · 277 without coordinates

Open the institutions mapphysical evidence429

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	87
Provo, US	68
DOI/NPS, Colonial National Historical Parklocation not on record	37
Flagstaff, US	34
Wuzhou, CN	30
Logan, US	26
Musee des Dinosaures d'Esperaza (Aude)location not on record	22
Denver, US	19
Grand Junction, US	12
Claremont, US	12
ASUlocation not on record	10
Phoenix, US	9
Durango, US	9
University of Stellenboschlocation not on record	7
Pullman, US	6
Orem, US	6
Pomona Collegelocation not on record	4
Moscow, US	3
Albuquerque, US	2
Riverside, US	2
Eastern Nevada Landscape Coalitionlocation not on record	2
Lincoln, US	2
Henderson, US	2
Chongqing Museumlocation not on record	2
Weber State Universitylocation not on record	2
McWane Science Centerlocation not on record	2
Bangkok, TH	2
US	1
Rocky Mountain Biological Laboratorylocation not on record	1
Chadron, US	1
Saint Louis, US	1
San Angelo, US	1
Cslocation not on record	1
Boise, US	1
EL PASO, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
SEINetlocation not on record	1

37 institutions · 429 of 429 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Penstemon comarrhenus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)