Penstemon cobaea

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records5 856

Data sources10

Biological traits17

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Penstemon cobaea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 856 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF5 856 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT763 Mbp

01Narrative

Penstemon cobaea is a flowering plant in the plantain family, commonly known as cobaea beardtongue, prairie beardtongue or foxglove penstemon. The plant is native to the central United States, primarily the Great Plains from Nebraska to Texas, with additional populations in the Ozarks of Missouri and Arkansas. There are also populations reported in the southwestern United States as well as in Illinois and Ohio, but these appear to be introductions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.07 mg

Seed mass max3.07 mg

Seed mass min3.07 mg

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf c439 mg/g

Leaf n13.01 mg/g

Specific leaf area (SLA)8.19 mm²/mg

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon cobaea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSDQ471707.1 ↗339 bp

ACGT

GCATTGTTTAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCG …

Penstemon cobaea 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon cobaea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size762 840 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon cobaea0.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–642n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

CCDB · book-fedorov — Smith E. B. 1964b

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

2n 642×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Piotrowska 1934

CCDB · book-atlas-flowering-plants — Piotrowska, T. 1937

n 82×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Freeman, C. C. & R. E. Brooks. 1988. Documented plant chromosome numbers 1988: 1. Chromosome counts for North American plants -- I. Sida 13: 241–250.

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 856 records

Wild obs. + sensor5 441

Museum / vouchered415

Range

Area of Occupancy AOO8 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 3 152≤1 km 572≤10 km 171>10 km 264

4 159 georeferenced · 1 282 without coordinates

Open the mapobservation + sensor5 441

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 22≤1 km 86≤10 km 168>10 km 25

301 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence415

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	153
Austin, US	58
BAYLUlocation not on record	49
Stephenville, US	16
Saint Louis, US	15
Denton, US	11
Chadron, US	11
EL PASO, US	8
Chongqing Museumlocation not on record	8
Riverside, US	8
Albuquerque, US	7
Wuzhou, CN	6
DOI/NPS, Colonial National Historical Parklocation not on record	6
WTUlocation not on record	5
Lincoln, US	5
Bangkok, TH	5
Bloomington, US	4
Pullman, US	4
Lubbock, US	3
Waverly, US	3
San Angelo, US	3
Claremont, US	2
GB	2
Columbia, US	2
Flagstaff, US	2
Mexico City, MX	2
Dekalb, US	1
University of Stellenboschlocation not on record	1
Bronx, US	1
Wellington, NZ	1
Armidale, AU	1
Moscow State Universitylocation not on record	1
Tempe, US	1
Denver, US	1
ASUlocation not on record	1
Philadelphia, US	1
Jena Microbial Resource Collectionlocation not on record	1
Burlington, US	1
Edmonton, CA	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Pittsburg, US	1

41 institutions · 413 of 415 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon cobaea

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type5 856 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions32 of 41 geolocated

Record type5 856 records