Penstemon clevelandii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records347

Data sources8

Biological traits9

DNA specimens6

eDNA detections2

Sources8 archives

Databases and archives Penstemon clevelandii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF347 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Penstemon clevelandii is a species of penstemon known by the common name Cleveland's beardtongue. It is native to southern California and Baja California, where it grows in mountain and desert habitat such as scrub, woodland, and chaparral. It is a perennial herb with upright, branching stems 70 centimeters in maximum height. The thick leaves are oval in shape, sometimes toothed, and 2 to 6 centimeters in length. The inflorescence produces tubular flowers with expanded, lipped mouths. The flower is pink to magenta in color, up to 2.4 centimeters in length, and somewhat glandular on the outer surface. Its specific epithet clevelandii honors 19th-century San Diego-based plant collector and lawyer Daniel Cleveland. There are three subtaxa recognized as varieties or subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.847 mg

⚠ sources differ — TRY: 0.847 mg · GIFT: 1.27 mg

Seed mass max1.7 mg

Seed mass min0.703 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

03Chemical composition2 compounds

Compounds documented for Penstemon clevelandii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon clevelandii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ531072.1 ↗601 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCGACGCCCCTC …

Penstemon clevelandii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type347 records

Wild obs. + sensor261

Museum / vouchered86

Origin

Native13

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 110≤1 km 21≤10 km 8>10 km 56

195 georeferenced · 66 without coordinates

Open the mapobservation + sensor261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 15≤1 km 17≤10 km 25>10 km 4

61 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	14
Los Angeles, US	12
Riverside, US	7
San Diego, US	6
Severin-McDaniel Insect Collectionlocation not on record	5
ASUlocation not on record	4
Northridge, US	4
Phoenix, US	4
Santa Barbara, US	4
Bronx, US	2
Ensenada, MX	2
US	2
The University of Arizonalocation not on record	2
CASlocation not on record	1
Davis, US	1
San Luis Obispo, US	1
Pullman, US	1
Canadian Department of Agriculturelocation not on record	1
Long Beach, US	1
Mexico City, MX	1
Arizona State University Biocollectionslocation not on record	1
WTUlocation not on record	1
La Paz, MX	1
San Francisco, US	1
EL PASO, US	1

25 institutions · 80 of 86 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Penstemon clevelandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Pinyon-Juniper woodland, Wash; decomposed gr…Eriognum fasciculatum, Salvia apiana, Opunti…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 15.6–18.0

Seasonal swing summer↔winter18.1 °C

Max temp (day)23.7 °C 22.2–25.2

Min temp (night)10.3 °C 9.50–11.0

Precipitation28.0 mm/mo 17.7–38.3

Air humidity48.0 % 46.2–49.7

Moisture balance-106 mm/mo -121–-90.8

Vapour deficit1,010 Pa 904–1,116

Wind speed3.00 m/s 2.70–3.40

Cloud cover34.0 % 33.6–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)