Penstemon californicus

(Munz & L M.Johnst.) D.D.Keck · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records332

Data sources8

Biological traits6

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Penstemon californicus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF332 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Penstemon californicus is a species of penstemon known by the common name California penstemon. It is native to Baja California and is also known from fewer than 20 occurrences in California, mainly in Orange and Riverside Counties. It grows in the forest and woodland habitat of the Peninsular Ranges and nearby slopes. This is a perennial herb with many spreading or upright branches 30 centimeters in maximum height. The leaves are no more than 1.5 centimeters long with linear or lance-shaped blades borne on petioles. The inflorescence produces tubular flowers between 1 and 2 centimeters long, purple to blue in color with dark-striped white throats containing hairy staminodes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass4.73 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment3

Climatesubtropical

Climberself-supporting

Growth formSubshrub, Forb/herb

03Chemical composition5 compounds

Compounds documented for Penstemon californicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
cyanidin-3,5-diglucoside	present	LOTUS
Delphinidin 3,5-diglucoside	present	LOTUS
Delphinidin 3-glucoside	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon californicus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ531067.1 ↗612 bp

ACGT

TCGAGACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGGAGGGGGTCGAGGCGCGAGGGTCGCAAGATCCCCCGTACCGACGCC …

Penstemon californicus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type332 records

Wild obs. + sensor135

Museum / vouchered197

Origin

Native13

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 33≤1 km 2≤10 km 3>10 km 82

120 georeferenced · 15 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 89≤1 km 11≤10 km 7>10 km 1

108 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	72
Claremont, US	31
Riverside, US	26
Ensenada, MX	9
Santa Barbara, US	8
Phoenix, US	7
CASlocation not on record	6
Mexico City, MX	5
Austin, US	5
Bronx, US	4
Los Angeles, US	3
ASUlocation not on record	3
Arizona State University Biocollectionslocation not on record	3
Flagstaff, US	1
Austin, US	1
La Paz, MX	1
University of Stellenboschlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Pullman, US	1
The University of Arizonalocation not on record	1
Calabar, NG	1

21 institutions · 190 of 197 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Penstemon californicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)