Penstemon caespitosus

Nutt. ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records508

Data sources10

Biological traits9

DNA specimens1

eDNA detections2

Sources10 archives

Databases and archives Penstemon caespitosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility508 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF508 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Penstemon caespitosus est une espèce de plantes à fleurs de la famille des Plantaginacées, originaire d'Amérique du Nord. Elle est connue sous le nom de Mat Beardtongue en anglais.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.26 mg

Seed mass max1.26 mg

Seed mass min1.26 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon caespitosus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ531065.1 ↗595 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon caespitosus var. caespitosus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon caespitosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · kew

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type508 records

Wild obs. + sensor137

Museum / vouchered371

Range

Area of Occupancy AOO1 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 85≤1 km 9≤10 km 5>10 km 5

104 georeferenced · 33 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 36≤1 km 109≤10 km 87>10 km 2

234 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	163
Musee des Dinosaures d'Esperaza (Aude)location not on record	38
Rocky Mountain Biological Laboratorylocation not on record	30
Logan, US	29
Denver, US	21
Provo, US	20
Flagstaff, US	13
Grand Junction, US	12
ASUlocation not on record	7
Durango, US	7
Bangkok, TH	5
Pocatello, US	4
Claremont, US	3
Boise, US	2
Albuquerque, US	2
USFSlocation not on record	2
Bandelier National Monumentlocation not on record	2
Weber State Universitylocation not on record	2
San Luis Obispo, US	1
Pullman, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Moscow, US	1
Oskarshamn, SE	1
Phoenix, US	1
CASlocation not on record	1
Riverside, US	1
Chadron, US	1

27 institutions · 371 of 371 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Penstemon caespitosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)