Penstemon azureus

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records420

Data sources10

Biological traits9

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Penstemon azureus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility420 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF420 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Penstemon azureus is a flowering plant species known by the common name azure penstemon. It is native to the mountains of Oregon and northern California. It grows in coniferous forests and woodlands in the Klamath Mountains, North California Coast Ranges, Southern Cascade Range, and Northern Sierra Nevada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.573 mg

⚠ sources differ — TRY: 0.573 mg · GIFT: 1.51 mg

Seed mass max2.44 mg

Seed mass min0.286 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

03Chemical composition2 compounds

Compounds documented for Penstemon azureus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon azureus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF375178.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGGCGCAAGTCCCCCGCGTCGACCCCCCT …

Penstemon azureus internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon azureus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records32–482n range40median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · kew

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

2n 481×CCDB · book-fedorov

CCDB · book-fedorov — Clausen J. et al. 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type420 records

Wild obs. + sensor214

Museum / vouchered206

Origin

Native6

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 113≤1 km 32≤10 km 15>10 km 5

165 georeferenced · 49 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 74≤10 km 47>10 km 3

125 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	29
Angwin, US	20
Santa Barbara, US	15
Logan, US	15
WTUlocation not on record	14
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	14
Pullman, US	9
San Diego, US	8
Fredericton Stock Culture Collectionlocation not on record	7
Davis, US	7
Canadian Department of Agriculturelocation not on record	7
Claremont, US	6
Northridge, US	4
Corvallis, US	4
US	3
San Luis Obispo, US	3
Riverside, US	3
San Jose, US	2
University of Stellenboschlocation not on record	2
Long Beach, US	2
EL PASO, US	1
Columbia, US	1
Portland, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
San Francisco, US	1
STNFlocation not on record	1
Chongqing Museumlocation not on record	1
KNFHClocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Flagstaff, US	1
ASUlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
South Kensington, GB	1
Bloomington, US	1

34 institutions · 188 of 206 vouchered records shown · 18 without an institution code

09Environmental DNA2 detections

Where the DNA of Penstemon azureus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)