Penstemon angustifolius

Nutt. ex Pursh · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 445

Data sources9

Biological traits90

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Penstemon angustifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 445 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 445 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Penstemon angustifolius est une espèce de plantes de la famille des Plantaginacées, originaire d'Amérique du Nord. Elle est connue sous le nom de Broadbeard Beardtongue en anglais.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.91 m

Seed mass3.46 mg

⚠ sources differ — TRY: 3.46 mg · GIFT: 2.45 mg

Seed mass max5.91 mg

Seed mass min1 mg

Life cycle & reproduction24

After harvest regrowth rateRapid

Bloom periodSpring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDARapid

Life formperennial

Life spanperennial

Lifespan categoryShort

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateSlow

Habitat & environment22

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourpurple

Growth formSubshrub, Forb/herb

Growth form USDASingle Stem

Hedge toleranceLow

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinessvariable

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantYes

Fire toleranceNone

Frost free days min160 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max35 in

Precipitation min9 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceHigh

Soil pH max8.5 pH

Soil pH min7 pH

Temperature min-28 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound313 000 per lb

ToxicityModerate

Veneer productNo

Other traits6

Fall conspicuousYes

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceNo

Planting density max30 000 per acre

Planting density min10 000 per acre

03Chemical composition1 compounds

Compounds documented for Penstemon angustifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon angustifolius has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ531059.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon angustifolius internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon angustifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

CCDB · book-fedorov — Nisbet, Jackson 1960

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 445 records

Wild obs. + sensor1 090

Museum / vouchered353

Cultivated / captive1

Other1

Range

Area of Occupancy AOO3 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 628≤1 km 98≤10 km 61>10 km 60

847 georeferenced · 243 without coordinates

Open the mapobservation + sensor1 090

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 17≤1 km 64≤10 km 85>10 km 16

182 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence353

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	66
Denver, US	56
Musee des Dinosaures d'Esperaza (Aude)location not on record	37
Lincoln, US	33
Flagstaff, US	17
Albuquerque, US	16
Chadron, US	12
Durango, US	11
Missoula, US	11
Logan, US	9
ASUlocation not on record	7
Pomona Collegelocation not on record	7
Chongqing Museumlocation not on record	6
Moscow, US	6
Provo, US	5
Tempe, US	5
Saint Louis, US	5
Spearfish, US	5
Phoenix, US	3
SEINetlocation not on record	3
Boise, US	3
Riverside, US	3
Grand Junction, US	2
University of Stellenboschlocation not on record	2
Rocky Mountain Biological Laboratorylocation not on record	2
Claremont, US	2
Bozeman, US	2
Los Angeles, US	2
Cheney, US	1
CASlocation not on record	1
Bronx, US	1
Chapel Hill, US	1
Oskarshamn, SE	1
PRClocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Burlington, US	1
University of New Hampshirelocation not on record	1
San Luis Obispo, US	1
Bangkok, TH	1
WTUlocation not on record	1

40 institutions · 350 of 353 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon angustifolius

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction24

Habitat & environment22

Physiology & chemistry19

Uses & economy15

Other traits6

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 445 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 40 geolocated

Cultivated / Captivenot free-living

Record type1 445 records