Penstemon anguineus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records468

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Penstemon anguineus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility468 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF468 records

DNA & barcodingNCBIsequences

01Narrative

Penstemon anguineus is a species of penstemon known by the common name Siskiyou beardtongue. It is native to the mountains of Oregon and northern California, where it grows in coniferous forests, often in open areas left by logging operations. It is a perennial herb reaching up to about 90 centimeters in maximum height. The oppositely arranged leaves are lance-shaped to oval, the ones higher on the plant clasping the stem. The inflorescence produces several light blue or purple flowers between 1 and 2 centimeters long. The sepals and flowers are coated in glandular hairs. The inside of the flower has many long hairs and the staminode has a sparse hair coating.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.362 mg

Seed mass max0.45 mg

Seed mass min0.307 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Penstemon anguineus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon anguineus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ534927.1 ↗605 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGTCCCT …

Penstemon anguineus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type468 records

Wild obs. + sensor69

Museum / vouchered399

Origin

Native4

Range

Area of Occupancy AOO1 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 44≤1 km 11≤10 km 4

59 georeferenced · 10 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 13≤1 km 136≤10 km 78>10 km 4

231 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence399

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	91
Angwin, US	76
Corvallis, US	34
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	17
WTUlocation not on record	11
Pullman, US	10
San Diego, US	8
Bronx, US	7
Davis, US	6
Santa Barbara, US	6
Ashland, US	6
Claremont, US	5
Riverside, US	5
Northridge, US	5
Canadian Department of Agriculturelocation not on record	4
Provo, US	4
STNFlocation not on record	3
Severin-McDaniel Insect Collectionlocation not on record	3
Wuzhou, CN	3
San Francisco, US	2
Bureau of Land Management, Medford District Officelocation not on record	2
KNFHClocation not on record	2
Moscow, US	2
CASlocation not on record	1
US	1
Pocatello, US	1
Portland, US	1
MeiseBGlocation not on record	1
University of Stellenboschlocation not on record	1
Phoenix, US	1
San Jose, US	1
The University of Arizonalocation not on record	1
ASUlocation not on record	1
Vancouver, CA	1
Boise, US	1
KNFYlocation not on record	1
Los Angeles, US	1

37 institutions · 326 of 399 vouchered records shown · 73 without an institution code