Penstemon albertinus

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 003

Data sources11

Biological traits88

DNA specimens7

eDNA detections4

Sources11 archives

Databases and archives Penstemon albertinus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 003 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources88 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 003 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT655 Mbp

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.61 m

Seed mass0.192 mg

Life cycle & reproduction24

After harvest regrowth rateRapid

Bloom periodSummer

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDARapid

Life formperennial

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateNone

Habitat & environment22

Active growth periodSummer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Growth form USDAMultiple Stem

Hedge toleranceHigh

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinessvariable

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceNone

Cold stratification requiredYes

Drought toleranceLow

Fertility requirementLow

Fire resistantYes

Fire toleranceLow

Frost free days min120 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max30 in

Precipitation min15 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7 pH

Soil pH min4.5 pH

Temperature min28 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound2 364 583 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceNone

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min1 700 per acre

03Chemical composition3 compounds

Compounds documented for Penstemon albertinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon albertinus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences7

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG217623.1 ↗253 bpCanada · 1969

ACGT

TTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAACTCAATCCCTCGGGTTTGATGGGGG …

Penstemon albertinus voucher CCDB-20338-E10 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon albertinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size655 260 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon albertinus0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Clausen J. et al. 1940b

CCDB · book-fedorov — Keck 1945

CCDB · book-atlas-flowering-plants — Keck 1945

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 003 records

Wild obs. + sensor463

Museum / vouchered540

Range

Area of Occupancy AOO2 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 252≤1 km 48≤10 km 31>10 km 20

351 georeferenced · 112 without coordinates

Open the mapobservation + sensor463

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 32≤1 km 76≤10 km 76>10 km 9

193 georeferenced · 347 without coordinates

Open the institutions mapphysical evidence540

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	161
Bronx, US	80
Moscow, US	54
WTUlocation not on record	38
Bozeman, US	32
Boise, US	21
Pullman, US	20
Caldwell, US	17
University of Lethbridgelocation not on record	16
Wuzhou, CN	12
Provo, US	11
Pocatello, US	11
Victoria, CA	10
University of Alberta Museumslocation not on record	9
Corvallis, US	6
Vancouver, CA	5
Logan, US	5
Bangkok, TH	4
Turlock, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
CASlocation not on record	2
Pittsburg, US	2
Madison, US	2
Research Collection of B. A. Bennettlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Saint Louis, US	1
Université Lavallocation not on record	1
Toronto, CA	1
University of Stellenboschlocation not on record	1
Riverside, US	1
Cheney, US	1
Columbia, US	1
Whitehorse, CA	1
Philadelphia, US	1
ASUlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1

37 institutions · 538 of 540 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Penstemon albertinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Damp grassy SW slope.Open, loose, shaly SW slopes and cliffsides.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 9.30–16.8

Seasonal swing summer↔winter24.4 °C

Max temp (day)19.1 °C 15.2–23.0

Min temp (night)7.20 °C 3.70–10.7

Precipitation132 mm/mo 76.1–187

Air humidity55.0 % 53.4–56.7

Moisture balance-11.8 mm/mo -86.5–63.0

Vapour deficit718 Pa 523–912

Wind speed3.80 m/s 3.50–4.20

Cloud cover36.1 % 34.1–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon albertinus

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction24

Habitat & environment22

Physiology & chemistry19

Uses & economy15

Other traits6

Compound class profile1 class

Documented compounds3 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 003 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 003 records