Penstemon acuminatus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records188

Data sources5

Biological traits88

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Penstemon acuminatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility188 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources88 traits

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF188 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.605 m

Seed mass1.09 mg

Seed mass max1.08 mg

Seed mass min1.08 mg

Life cycle & reproduction24

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life formperennial

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsNo

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min14 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min110 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max30 in

Precipitation min12 in

Salinity toleranceLow

Shade toleranceHigh

Soil pH max8 pH

Soil pH min6 pH

Temperature min-33 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityField Collections Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

03Chemical composition9 compounds

Compounds documented for Penstemon acuminatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Menthane monoterpenoids5

Caryophyllane sesquiterpenoids1

Himachalane sesquiterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(2,4-Dihydroxy-6-methyl-3-propan-2-ylphenyl) acetate	present	NPASS
(3,4-Dihydroxy-5-methyl-2-propan-2-ylphenyl) acetate	present	NPASS
(3-Acetyloxy-4-hydroxy-5-methyl-2-propan-2-ylphenyl) acetate	present	NPASS
(4aR,5S,9S,9aS)-9-(hydroxymethyl)-2,5,9-trimethyl-4,4a,6,7,8,9a-hexahydro-3H-benzo[7]annulen-5-ol	present	NPASS
(5-Methyl-3,6-dioxo-2-propan-2-ylcyclohexa-1,4-dien-1-yl) acetate	present	NPASS
2-Isopropyl-5-methylphenol	present	NPASS
2-Isopropyl-5-methylphenol acetate	present	NPASS
Thymoquinone	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon acuminatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ534923.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCAAGTGGCCCCCGTGCCGACGCCCCT …

Penstemon acuminatus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type188 records

Wild obs. + sensor125

Museum / vouchered63

Origin

Native1

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 82≤1 km 8≤10 km 6>10 km 7

103 georeferenced · 22 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 6≤1 km 26≤10 km 26>10 km 2

60 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	56
Flagstaff, US	3
Albuquerque, US	1
Claremont, US	1
Grand Junction, US	1
ASUlocation not on record	1

6 institutions · 63 of 63 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)