Pennantia corymbosa

J.R.Forst. & G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pennantiaceae/Pennantia

At a glance

Occurrence records4 961

Data sources8

Biological traits39

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Pennantia corymbosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 961 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources39 traits

Occurrence & distributionGBIF4 961 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Pennantia corymbosa — типовой вид рода Пеннантия (лат. Pennantia) семейства Пеннантиевые (лат. Pennantiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology16

Fruit length9 mm

Leaf length max80 mm

Leaf width25 mm

Leaf width max25 mm

Leaf width min25 mm

Plant height4.5 m

Plant height max10 m

Seed length5.5 mm

Seed length max5.5 mm

Seed length min5.5 mm

Seed mass16.96 mg

Seed mass max19.9 mg

Seed mass min14 mg

Seed volume27 mm³

Seed volume max27 mm³

Seed volume min27 mm³

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Sex typedioecious

Habitat & environment5

Climatesubtropical

Growth formtree

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio15.89 g/g

Leaf c471 mg/g

Leaf dry-matter content (LDMC)293 mg/g

Leaf n25.66 mg/g

Leaf p1.63 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.6 mm²/mg

Wood density451 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pennantia corymbosa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ499120.1 ↗629 bpNew Zealand

ACGT

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTACGTTATGACCGGGCGCCCGGCGAGGGGAGCTCCCCGAGCCGTGCCCCAACGGC …

Pennantia corymbosa from New Zealand internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pennantia corymbosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Chromosome records50–502n range50median50mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 503×CCDB · new-zealand · CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · new-zealand

CCDB · ipcn-api-dl — Murray, B. G. & P. J. d. Lange. 1995. Chromosome numbers in the rare endemic Pennantia baylisiana (W. R. B. Oliv.) G. T. S. Baylis (Icacinaceae) and related species. New Zealand J. Bot. 33: 563–564.

CCDB · book-fedorov — Hair, Beuzenberg 1959

n 251×CCDB · Cave1959

CCDB · Cave1959 — Hair & Beuz. 1959

08Occurrence & distribution

Record type4 961 records

Wild obs. + sensor4 113

Museum / vouchered846

Cultivated / captive2

Origin

Native14

Range

Area of Occupancy AOO8 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 000≤1 km 376≤10 km 98>10 km 44

3 518 georeferenced · 595 without coordinates

Open the mapobservation + sensor4 113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 16≤1 km 12≤10 km 17>10 km 1

46 georeferenced · 800 without coordinates

Open the institutions mapphysical evidence846

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	179
Wellington, NZ	108
Christchurch, NZ	70
Rotorua, NZ	32
Palmerston North, NZ	12
Hobart, AU	7
LDlocation not on record	3
New Zealand Arthropod Collectionlocation not on record	3
Smithfield, AU	2
Vancouver, CA	1
Chicago, US	1
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Saint Louis, US	1
Wlocation not on record	1
Uppsala, SE	1
SNSNMClocation not on record	1

17 institutions · 424 of 846 vouchered records shown · 421 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Pennantia corymbosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pennantia corymbosa

At a glance

Sources8 archives

Size & morphology16

Life cycle & reproduction9

Habitat & environment5

Physiology & chemistry9

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 961 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 961 records