Peniocereus greggii

(Engelm.) Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Peniocereus

At a glance

Occurrence records142

Data sources12

Biological traits9

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Peniocereus greggii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility142 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF142 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Peniocereus greggii is a cactus species native to Arizona, New Mexico, Texas (USA); and Chihuahua, Coahuila, Durango, Sonora, and Zacatecas (Mexico).Flora of North America - Peniocereus greggii Common names include Arizona queen of the night, nightblooming cereus and Reina de la noche. The species name greggii honors Josiah Gregg (1806 – 1850), a merchant, explorer, naturalist, and author of the American Southwest and Northern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formscrambling succulent tuberous shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Peniocereus greggii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cholestane steroids $ Ecdysteroids4

Cholestane steroids2

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,5R,9S,10S,13R,14R,17R)-3-hydroxy-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-6-one	present	LOTUS
(3R,5S,9S,10S,13R,14S,17R)-3,9,14-trihydroxy-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-1,2,3,4,5,11,12,15,16,17-decahydrocyclopenta[a]phenanthren-6-one	present	LOTUS
(3S,5S,6S,10S,13S,14R,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,5,6,7,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3,6-diol	present	LOTUS
(3S,5S,9R,10R,13S,14S,17R)-3-hydroxy-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-6-one	present	LOTUS
[(3R,5S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-6-oxo-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS
[(3R,5S,9S,10S,13R,14R,17S)-9-hydroxy-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-6-oxo-2,3,4,5,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peniocereus greggii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKHM041755.1 ↗2 395 bp

ACGT

CATCGGTAGAGTTTATCAGACCACGACTGATCCTGAAAGGAAATGAATGGAAAAAAGAGCATGTCGTATCAATAGAGAATTCGGAGAATA …

Peniocereus greggii trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Peniocereus greggii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · eflora

CCDB · eflora

n 111×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — PINKAVA, D.J., & M.G. MCLEOD. 1971. Chromosome numbers in some cacti of western North America. Brittonia 23: 171-176.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type142 records

Wild obs. + sensor130

Museum / vouchered12

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 32≤1 km 7≤10 km 2>10 km 84

125 georeferenced · 5 without coordinates

Open the mapobservation + sensor130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 8

8 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	5
Durango, MX	3
Bronx, US	1
Riverside, US	1
Saint Louis, US	1
Austin, US	1

6 institutions · 12 of 12 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Peniocereus greggii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)