Penicillium granulatum — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records38

Data sources11

Biological traits0

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Penicillium granulatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

OBISOcean Biodiversity Information System17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF · OBIS38 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Penicillium granulatum Bainier – gatunek grzybów z klasy Eurotiomycetes. Mikroskopijne grzyby strzępkowe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition12 compounds

Compounds documented for Penicillium granulatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclopiane diterpenoids6

Cholestane steroids $ Ergostane steroids4

Halimane diterpenoids2

Imidazole alkaloids1

Miscellaneous polyketides1

Documented compounds12 total

Compound	Amount	Source
(1R,2R,6S,9S,10S,14S)-2,6,10,11,11,14-hexamethyltetracyclo[7.6.0.01,6.010,14]pentadec-3-en-5-one	present	LOTUS
(4~{S})-4-oxidanyl-4,6-dihydrofuro[3,2-c]pyran-2-one	present	LOTUS
Conidiogenone C	present	LOTUS
Conidiogenone I	present	LOTUS
Loratadine	present	LOTUS
Penicisteroid D	present	LOTUS
Penicisteroid E	present	LOTUS
Penicisteroid F	present	LOTUS
Penicisteroid G	present	LOTUS
Penicisteroid H	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium granulatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections2

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPZ013051.1 ↗523 bpPoland · 2021

ACGT

GGTCACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCG …

Penicillium granulatum isolate UWR_890 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor1

Museum / vouchered36

Other1

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 36 records without

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	1

1 institutions · 1 of 36 vouchered records shown · 18 without an institution code

09Environmental DNA2 detections

Where the DNA of Penicillium granulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.