Penicillium expansum

Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records1 332

Data sources12

Biological traits0

DNA specimens53

eDNA detections589

Sources12 archives

Databases and archives Penicillium expansum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility765 records↗

OBISOcean Biodiversity Information System567 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI589 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS131 compounds

Occurrence & distributionGBIF · OBIS1 332 records

Environmental DNA4 datasets · 3 countries589 detections

DNA & barcodingBOLD · NCBI53 specimens

Genome at a glanceGoaT · NCBI32 Mbp

01Narrative

Penicillium expansum est une espèce de champignons microscopiques du genre Penicillium. C'est un agent de pourriture des fruits. Il peut produire une mycotoxine, la patuline. Cette espèce peut contaminer les jus de fruits et les compotes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition131 compounds

Compounds documented for Penicillium expansum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pregnane steroids51

Aspidosperma type12

Azaphilones10

Pyrroloindole alkaloids7

Bisabolane sesquiterpenoids5

Documented compounds131 total

Tissue Source Quantified only

Compound	Amount	Source
(1E,4S,5R,8S,13R,16R,19R,22R)-8-[(2R,3R,4R,5R,6R)-3-hydroxy-5-[(2S,4S,5S,6S)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-5,19-dimethyl-15,18,20-trioxapentacyclo[14.5.1.04,13.05,10.019,22]docosa-1,10-diene-14,21-dione	present	NPASS
(1R,3S)-8-methoxy-3,5-dimethyl-3,4-dihydro-1H-isochromene-1,6-diol	present	LOTUS
(1R,4Z,7R,9S)-4-(1H-imidazol-5-ylmethylidene)-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(1S,2R,6R,7R,8aR)-7-hydroxy-6-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4S,5R,6S)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-8a-methyl-1-[3-(2-methylfuran-3-yl)-3-oxopropyl]-2,3,5,6,7,8-hexahydro-1H-naphthalene-2-carboxylic acid	present	NPASS
(1S,3R)-8-methoxy-3,5-dimethyl-3,4-dihydro-1H-isochromene-1,6-diol	present	LOTUS
(1S,3S)-1-ethoxy-8-methoxy-3,5-dimethyl-3,4-dihydro-1H-isochromen-6-ol	present	LOTUS
(2E,4E)-1-[(2R,6S,14S,22S,25R)-25-[(2S)-3,3-dimethyloxiran-2-yl]-1,3,13,15-tetrazaheptacyclo[18.4.1.02,6.06,22.07,12.014,22.016,21]pentacosa-7,9,11,16,18,20-hexaen-3-yl]hexa-2,4-dien-1-one	present	LOTUS
(2R,4aS,4bR,6R,7R,10aR)-6,7-dihydroxy-2,4b-dimethyl-2-(2-methylfuran-3-yl)-4,4a,5,6,7,8,10,10a-octahydro-3H-phenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6,7-dihydroxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS
(2R,4aS,4bR,6R,7R,10aR)-6-hydroxy-7-[(2R,4R,5S,6S)-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4b-methyl-2-(2-methylfuran-3-yl)-2,3,4,4a,5,6,7,8,10,10a-decahydrophenanthren-1-one	present	NPASS

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium expansum has left across the world's sequence archives.

At a glance

DNA specimens53

Marker genes5

GenBank sequences10

eDNA detections589

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPZ135084.1 ↗361 bpPoland · 2022

ACGT

CTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTTTGGGTCCAACCTCCCACCCGTGTTTATTTACCTCGTTGCTTC …

Penicillium expansum isolate UWR_1161 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_079663 ↗ · 15 protein · 25 tRNA · 1 rRNA

cytochrome c oxidase subunit Ihypothetical proteinATP synthase F0 subunit cNADH dehydrogenase subunit 3cytochrome c oxidase subunit IINADH dehydrogenase subunit 4LNADH dehydrogenase subunit 5NADH dehydrogenase subunit 2apocytochrome bNADH dehydrogenase subunit 1NADH dehydrogenase subunit 4ATP synthase F0 subunit 8ATP synthase F0 sector subunit aNADH dehydrogenase subunit 6cytochrome c oxidase subunit 3small subunit ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium expansum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size32 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium expansum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.5% BUSCO

08Occurrence & distribution

Record type1 332 records

Wild obs. + sensor100

Museum / vouchered1 182

Cultivated / captive42

Other8

Range

Area of Occupancy AOO496 km²

Depth

0–200 m sunlit540

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 10 m · 540 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 18≤1 km 7≤10 km 55>10 km 3

83 georeferenced · 17 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤10 km 4>10 km 6

12 georeferenced · 1 170 without coordinates

Open the institutions mapphysical evidence1 182

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 39 without coordinates

Open the mapnot free-living42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	14
National Institute of Biological Resourceslocation not on record	6
Pullman, US	2
Lincoln, US	2
Kew, GB	2
Auckland, NZ	2
Université de Montréal Biodiversity Centrelocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
Tartu, EE	1
Catholic University of Pekinglocation not on record	1
Uppsala, SE	1
Helsinki, FI	1

13 institutions · 38 of 1 182 vouchered records shown · 584 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA589 detections

Where the DNA of Penicillium expansum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found589

Studies independent surveys4

Countries3

Verifiable raw sequence linked542

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 589 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–16.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.6 °C 9.10–18.1

Min temp (night)9.90 °C 6.10–14.5

Precipitation94.2 mm/mo 77.6–143

Air humidity64.3 % 63.4–65.2

Vapour deficit507 Pa 368–655

Cloud cover59.5 % 55.9–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 543 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penicillium expansum

At a glance

Sources12 archives

Compound class profile5 classes

Documented compounds131 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 332 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 332 records