Penicillium digitatum

(Pers.) Sacc. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records551

Data sources12

Biological traits0

DNA specimens16

eDNA detections18

Sources12 archives

Databases and archives Penicillium digitatum's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

OBISOcean Biodiversity Information System81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF · OBIS551 records

Environmental DNA4 datasets · 3 countries18 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceGoaT · NCBI26 Mbp

01Narrative

Penicillium digitatum (/ˌpɛnɪˈsɪlɪəm/digitatum/) is a mesophilic fungus found in the soil of citrus-producing areas. It is a major source of post-harvest decay in fruits and is responsible for the widespread post-harvest disease in Citrus fruit known as green rot or green mould. In nature, this necrotrophic wound pathogen grows in filaments and reproduces asexually through the production of conidiophores and conidia. However, P. digitatum can also be cultivated in the laboratory setting. Alongside its pathogenic life cycle, P. digitatum is also involved in other human, animal and plant interactions and is currently being used in the production of immunologically based mycological detection assays for the food industry.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition10 compounds

Compounds documented for Penicillium digitatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinazoline alkaloids2

Ergostane steroids1

Cholestane steroids $ Ergostane steroids1

Lanostane, Tirucallane and Euphane triterpenoids1

Cholestane steroids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
24-Methylene-24-dihydrolanosterol	present	LOTUS
Cholesterol	present	LOTUS
Episterol	present	LOTUS
Ergosta-7,22,24(28)-trien-3beta-ol	present	LOTUS
Methyl (2-hydroxyphenyl)acetate	present	LOTUS
phenylacetate	present	LOTUS
Stellasterol	present	LOTUS
Terpinolene	present	LOTUS
Tryptoquialanine	present	LOTUS
Tryptoquialanine B	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium digitatum has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes2

GenBank sequences10

eDNA detections18

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPZ277115.1 ↗366 bpChina · 2022

ACGT

AAAACCAAAGGAGGGAAATCTGGGTCCACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTTACTGGCCGCCGGG …

Penicillium digitatum strain FSS34 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillium marinumsame genus1.5%Penicillium ulaiensesame genus1.8%Penicillium italicumsame genus2.0%Penicillium coprophilumsame genus2.9%Penicillium camembertisame genus3.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_015080 ↗ · 15 protein · 27 tRNA · 2 rRNA

cytochrome c oxidase subunit 1ATP synthase subunit 9NADH dehydrogenase subunit 3cytochrome c oxidase subunit 2NADH dehydrogenase subunit 4LNADH dehydrogenase subunit 5NADH dehydrogenase subunit 2cytochrome bNADH dehydrogenase subunit 1NADH dehydrogenase subunit 4ATP synthase subunit 8ATP synthase subunit 6NADH dehydrogenase subunit 6cytochrome c oxidase subunit 3ribosomal protein S5small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium digitatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size25 975 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium digitatum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type551 records

Wild obs. + sensor295

Museum / vouchered245

Cultivated / captive10

Other1

Range

Area of Occupancy AOO1 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 163≤1 km 34≤10 km 15>10 km 32

244 georeferenced · 51 without coordinates

Open the mapobservation + sensor295

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 1≤10 km 9>10 km 4

14 georeferenced · 231 without coordinates

Open the institutions mapphysical evidence245

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 9 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	28
Bronx, US	6
Bernard Price Institute for Palaeontological Researchlocation not on record	5
ILLSlocation not on record	5
Auckland, NZ	4
Pullman, US	2
Lincoln, US	2
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	2
UAclocation not on record	1
Karlsruhe, DE	1
Champaign, US	1
Catholic University of Pekinglocation not on record	1

12 institutions · 58 of 245 vouchered records shown · 108 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Penicillium digitatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys4

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

Soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.84

Conductivity13.0 µS/cm

Organic carbon0.17 %

Depth0.2 m

SoilKandosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 8.30–25.1

Seasonal swing summer↔winter12.2 °C

Max temp (day)29.7 °C 13.8–30.5

Min temp (night)17.4 °C 3.80–19.3

Precipitation109 mm/mo 34.1–272

Air humidity52.9 % 52.0–64.8

Moisture balance-17.8 mm/mo -93.5–169

Vapour deficit1,417 Pa 522–1,616

Wind speed2.60 m/s 1.80–3.90

Cloud cover28.6 % 25.2–55.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)