Penicillium brevicompactum

Dierckx · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records2 234

Data sources13

Biological traits0

DNA specimens92

eDNA detections1 845

Sources13 archives

Databases and archives Penicillium brevicompactum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 384 records↗

OBISOcean Biodiversity Information System850 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 845 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS82 compounds

Occurrence & distributionGBIF · OBIS2 234 records

Environmental DNA11 datasets · 42 countries1 845 detections

DNA & barcodingBOLD · NCBI92 specimens

Genome at a glanceGoaT · NCBI32 Mbp

01Narrative

Penicillium brevicompactum is a mould species in the genus Penicillium. Mycophenolic acid can be isolated from P. brevicompactum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition82 compounds

Compounds documented for Penicillium brevicompactum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phthalide derivatives11

Indole diketopiperazine alkaloids (L-Trp, L-Pro)7

Pyrrole alkaloids6

Breviane diterpenoids $ Spriromeroterpenoids5

Other indole diketopiperazine alkaloids4

Documented compounds82 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-brevicolide A	present	LOTUS
(+)-brevicolide B	present	LOTUS
(-)-brevicolide A	present	LOTUS
(-)-brevicolide B	present	LOTUS
(1'R,2R,7'R,9'S)-10',10'-dimethylspiro[1H-indole-2,11'-3-azatetracyclo[5.5.2.01,9.03,7]tetradecane]-2',3,14'-trione	present	LOTUS
(1S,4R,7S,9R)-4-[(2R)-butan-2-yl]-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(1S,4R,7S,9R)-4-[(2S)-butan-2-yl]-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(2R)-1-(2,3-dihydropyrrol-1-yl)-2-methyldecane-1,3-dione	present	LOTUS
(2R)-2-methyl-1-pyrrol-1-yldecane-1,3-dione	present	LOTUS
(3'S)-(E)-7-hydroxy-5-methoxy-4-methyl-6-(2-(2-methyl-5-oxotetrahydrofuran-2-yl)vinyl)isobenzofuran-1(3H)-one	present	LOTUS

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium brevicompactum has left across the world's sequence archives.

At a glance

DNA specimens92

Marker genes5

GenBank sequences10

eDNA detections1 845

Countries42

The DNA barcodea real sequence read deposited for this species

ITSPZ277084.1 ↗403 bpChina · 2022

ACGT

CCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCC …

Penicillium brevicompactum strain FLT14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillium olsoniisame genus2.6%Penicillium bialowiezensesame genus2.8%Penicillium soppiisame genus7.2%Penicillium buchwaldiisame genus7.7%Penicillium vulpinumsame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NW_026623211 ↗ · 2 protein

CDS

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium brevicompactum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size31 895 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium brevicompactum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 234 records

Wild obs. + sensor280

Museum / vouchered1 924

Cultivated / captive29

Other1

Range

Area of Occupancy AOO1 076 km²

Depth

0–200 m sunlit541

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 10 m · 541 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 23≤1 km 16≤10 km 234>10 km 2

275 georeferenced · 5 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 3≤10 km 2>10 km 3

9 georeferenced · 1 915 without coordinates

Open the institutions mapphysical evidence1 924

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the mapnot free-living29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	5
Sydney Medical Schoollocation not on record	3
National Institute of Biological Resourceslocation not on record	3
Uppsala, SE	3
CA	2
Kew, GB	2
Research Collection of Keith Seifertlocation not on record	1
ARMS-MBONlocation not on record	1
UAclocation not on record	1
Pullman, US	1
Chicago, US	1
Auckland, NZ	1
MeiseBGlocation not on record	1
Toronto, CA	1
California State University, East Baylocation not on record	1
Universidad Nacional Santiago Antunez De Mayololocation not on record	1
LDlocation not on record	1
SLU Artdatabankenlocation not on record	1

18 institutions · 30 of 1 924 vouchered records shown · 1 052 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 845 detections

Where the DNA of Penicillium brevicompactum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 845

Studies independent surveys11

Countries42

Verifiable raw sequence linked546

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 845 detections have coordinates

Open the map42 countries0

WetlandPalearcticAfrotropicNeotropicMarina; semi-industrial; 9.5 - Subtidal Sand…Nearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 8.10–19.1

Seasonal swing summer↔winter18.8 °C

Max temp (day)16.0 °C 9.60–22.5

Min temp (night)10.4 °C 6.10–15.5

Precipitation77.9 mm/mo 50.0–144

Air humidity63.4 % 58.5–65.2

Moisture balance16.2 mm/mo

Vapour deficit590 Pa 380–824

Wind speed4.10 m/s

Cloud cover47.0 % 34.6–64.4

CHELSA 1981–2010, ~9 km grid, at location & month of 1 698 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penicillium brevicompactum

At a glance

Sources13 archives

Compound class profile5 classes

Documented compounds82 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 234 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 234 records