Penicillaria jocosatrix

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Euteliidae/Penicillaria

At a glance

Occurrence records381

Data sources7

Biological traits0

DNA specimens34

eDNA detections29

Sources7 archives

Databases and archives Penicillaria jocosatrix's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility381 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF381 records

Environmental DNA1 datasets · 8 countries29 detections

DNA & barcodingBOLD34 specimens

01Narrative

Penicillaria jocosatrix, the mango shoot borer, is a moth of the family Noctuidae first described by Achille Guenée in 1852. It is found from southeast Asia to the Pacific. Records include Borneo, Guam, Hawaii, India, Sri Lanka, Thailand and in Australia, Western Australia, the Northern Territory and Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillaria jocosatrix has left across the world's sequence archives.

At a glance

DNA specimens34

BINs4

Marker genes3

eDNA detections29

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

7Amostly conserved

13Tmostly conserved

14Amostly conserved

18Tmostly conserved

19Cmostly conserved

25Tvariable

50Tmostly conserved

52Amostly conserved

91Tmostly conserved

154Tmostly conserved

163Tmostly conserved

193Cmostly conserved

211Gvariable

212Tmostly conserved

235Cmostly conserved

238Cvariable

263Tmostly conserved

271Cvariable

284Tmostly conserved

286Amostly conserved

340Tmostly conserved

364Cvariable

379Amostly conserved

400Tmostly conserved

415Amostly conserved

428Tmostly conserved

436Cvariable

445Tmostly conserved

499Amostly conserved

508Amostly conserved

514Tmostly conserved

529Amostly conserved

533Cmostly conserved

535Tmostly conserved

539Cmostly conserved

541Tmostly conserved

547Cvariable

568Amostly conserved

574Tmostly conserved

586Amostly conserved

622Tmostly conserved

628Avariable

658Tmostly conserved

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes5

BINs4

Most divergent pair8.8%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillaria simplexsame genus4.9%Penicillaria meekisame genus5.0%Penicillaria dorsipunctasame genus5.0%Blenina lichenosasame order6.5%Paectes kebeaesame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type381 records

Wild obs. + sensor268

Museum / vouchered113

Origin

Native5

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 98≤1 km 44≤10 km 14>10 km 13

169 georeferenced · 99 without coordinates

Open the mapobservation + sensor268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	59
Helsinki, FI	18
Museums Victorialocation not on record	14
SUVlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	3
Taiwan Forestry Research Institutelocation not on record	2
Naturalis Biodiversity Centerlocation not on record	1
Essig Museum of Entomologylocation not on record	1
Loyola College, Entomology Research Institutelocation not on record	1
Cornell University Insect Collectionlocation not on record	1

10 institutions · 105 of 113 vouchered records shown · 7 without an institution code

09Environmental DNA29 detections

Where the DNA of Penicillaria jocosatrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map8 countries0

MangoMixed Deciduous Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 20.6–27.8

Seasonal swing summer↔winter7.20 °C

Max temp (day)28.5 °C 24.2–30.4

Min temp (night)21.4 °C 16.8–24.3

Precipitation179 mm/mo 65.9–369

Air humidity64.4 % 57.5–67.7

Moisture balance62.9 mm/mo

Vapour deficit1,096 Pa 905–1,379

Wind speed2.10 m/s

Cloud cover39.0 % 25.2–63.9

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)