Pembertonia latisquamea

(F.Muell.) P.S.Short · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pembertonia

At a glance

Occurrence records243

Data sources8

Biological traits12

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Pembertonia latisquamea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Pembertonia latisquamea is a species of daisy (Asteraceae), native to Western Australia. It was first described by Ferdinand von Mueller in 1878 as Brachyscome latisquamea and transferred to the genus, Pembertonia in 2004 by Philip Short. It is a climber or a shrub growing to 1.45 metres high, on white sand, red sand, silty clay and limestone, and flowers from September to October or July.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology5

Plant height1.45 m

Plant height max1.45 m

Seed mass0.517 mg

⚠ sources differ — AusTraits: 0.517 mg · GIFT: 36 mg

Seed mass max36 mg

Seed mass min36 mg

Life cycle & reproduction2

Flowering timennnnnnyyyynn

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climberobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber shrub · TRY: climber

Woodinesswoody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pembertonia latisquamea has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP175245.1 ↗629 bpUSA · 1994

ACGT

TCGAAGCCTGCAAAGCAGAACGACCAGCGAAAATGTTATAACAACCATGCCAGGATGGGTCGGGCGTCAGTCTGATCCTCGTGGCAACCG …

Pembertonia latisquamea isolate AH03 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pembertonia latisquamea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, Y. Suzuki, M. Ito, T. Yahara & K. Kosuge. 1996. Chromosome number determinations in the Australian Astereae (Asteraceae). Muelleria 9: 197–228.

CCDB · ipcn-api-dl — Watanabe, K., T. Yahara, T. Denda & K. Kosuge. 1999. Chromosomal evolution in the genus Brachyscome (Asteraceae, Astereae): statistical tests regarding correlation between changes in karyotype and habit using phylogenetic information. J. Pl. Res. 112: 145–161.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type243 records

Wild obs. + sensor112

Museum / vouchered129

Cultivated / captive2

Origin

Native9

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 70≤1 km 21≤10 km 6>10 km 2

99 georeferenced · 13 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 18≤1 km 17≤10 km 74>10 km 6

115 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence129

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	71
Museo Entomologico de Leonlocation not on record	23
Canberra, AU	14
Mount Annan, AU	8
Adelaide, AU	7
BGPAlocation not on record	4
Kew, GB	1
Palmerston, AU	1

8 institutions · 129 of 129 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pembertonia latisquamea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)