Peltogyne purpurea

Pittier · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Peltogyne

At a glance

Occurrence records203

Data sources8

Biological traits18

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Peltogyne purpurea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF203 records

DNA & barcodingNCBIsequences

01Narrative

Peltogyne purpurea, commonly known as nazareno, or purpleheart, is a species of Peltogyne tree native to the Pacific coast of Costa Rica and Panama, and also the Atlantic coast of Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height30 m

Seed length max30 mm

Seed length min15 mm

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density790 mg/cm³

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peltogyne purpurea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKPP449193.1 ↗606 bpCosta Rica

ACGT

CTTCACGAGTATTGTAATTGGAACATTCGTATTACTTCAAAAAAATCGATTTCTACTTTTTCAAACAGGAATCCAAGATTCGTCTTGTTC …

Peltogyne purpurea isolate LEGMi157 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor88

Museum / vouchered115

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 4≤1 km 3≤10 km 4>10 km 5

16 georeferenced · 72 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	30
Saint Louis, US	26
Museo Nacional de Costa Rica (MNCR)location not on record	17
San José, CR	10
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	6
Kew, GB	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Provincia di Livornolocation not on record	3
Fundación Desarrollo y Ambiente FUNDAlocation not on record	3
Chicago, US	3
IAvHlocation not on record	1
Mexico City, MX	1
CJBGlocation not on record	1
Berlin, DE	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
BMlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
ASUlocation not on record	1

18 institutions · 115 of 115 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)