Pellasimnia brunneiterma

(C.N.Cate, 1969) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Ovulidae/Pellasimnia

At a glance

Occurrence records102

Data sources6

Biological traits2

DNA specimens7

eDNA detections0

Sources6 archives

Databases and archives Pellasimnia brunneiterma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

OBISOcean Biodiversity Information System18 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS102 records

DNA & barcodingBOLD7 specimens

01Narrative

Pellasimnia brunneiterma is a species of sea snail, a marine gastropod mollusc in the family Ovulidae. This species appears to be a cryptic species triad.[1].

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pellasimnia brunneiterma has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

1Tmostly conserved

554Gmostly conserved

568Tmostly conserved

631Tvariable

TACCTTATATATCCTATTTGGTATGTGGTCTGGGTTAGTTGGTACAGCGCTTAGTTTACTGATTCGGGCAGAGTTAGGTCAGCCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Quasisimnia robertsonisame family13.1%Cymbovula acicularissame family13.3%Cyphoma gibbosumsame family14.3%Cyphoma signatumsame family14.5%Phenacovolva roseasame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor15

Museum / vouchered87

Range

Area of Occupancy AOO168 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 52 m · max 65 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 1≤1 km 3≤10 km 2>10 km 7

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤1 km 15≤10 km 4>10 km 2

21 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	55
Paris, FR	5
Natural History Museum Rotterdamlocation not on record	3
Sydney, AU	3
Philadelphia, US	2
Denver, US	1

6 institutions · 69 of 87 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)