Pellaea paradoxa

(R.Br.) Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Pteridaceae/Pellaea

At a glance

Occurrence records1 724

Data sources6

Biological traits16

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pellaea paradoxa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 724 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 724 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 58

01Narrative

Pellaea paradoxa (R.Br.) Hook. là một loài dương xỉ trong họ Pteridaceae. Loài này được Hook. mô tả khoa học đầu tiên. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology6

Leaf length75 mm

Leaf length max5 mm

Leaf length min1 mm

Leaf width14 mm

Leaf width max90 mm

Leaf width min40 mm

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formfern

⚠ sources differ — AusTraits: fern · TRY: F

Leaf compoundnesscompound

Leaf shapeovate terete widely_ovate

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)10.09 mm²/mg

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pellaea paradoxa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMT080332.1 ↗1 244 bp

ACGT

TTGACCTATTACACTCCCGAATACAAGACCAAAGACACTGATATCTTAGCAGCTTTCCGAATGACCCCTCAACCTGGAGTACCGGCTGAG …

Pellaea paradoxa voucher MELU P118514a ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pellaea paradoxa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Chromosome records58–1162n range87median58mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 581×CCDB · barker-ferns

CCDB · barker-ferns — Tindale, Mary D., and S. K. Roy. "A cytotaxonomic survey of the Pteridophyta of Australia."Australian Systematic Botany15.6 (2002): 839-937.

2n 1161×CCDB · barker-ferns

CCDB · barker-ferns — Tindale, Mary D., and S. K. Roy. "A cytotaxonomic survey of the Pteridophyta of Australia."Australian Systematic Botany15.6 (2002): 839-937.

08Occurrence & distribution

Record type1 724 records

Wild obs. + sensor1 252

Museum / vouchered365

Cultivated / captive1

Other106

Origin

Native105

Range

Area of Occupancy AOO4 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 061≤1 km 65≤10 km 33>10 km 26

1 185 georeferenced · 67 without coordinates

Open the mapobservation + sensor1 252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 68≤1 km 36≤10 km 137>10 km 49

290 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence365

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	106
Mount Annan, AU	105
Museo Entomologico de Leonlocation not on record	38
Canberra, AU	29
Smithfield, AU	26
Armidale, AU	15
Parkville, AU	11
Wellington, NZ	7
John T. Waterhouse Herbariumlocation not on record	6
Adelaide, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
New Brunswick, US	1
James Cook Townsvillelocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Auckland, NZ	1
Saint Louis, US	1
South Kensington, GB	1
Burlington, US	1
Palmerston, AU	1

19 institutions · 360 of 365 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pellaea paradoxa

At a glance

Sources6 archives

Size & morphology6

Life cycle & reproduction1

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 724 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 19 geolocated

Cultivated / Captivenot free-living

Record type1 724 records