Pellaea nana

(Hook.) Bostock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Pteridaceae/Pellaea

At a glance

Occurrence records1 834

Data sources6

Biological traits21

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pellaea nana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 834 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF1 834 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 116

01Narrative

Pellaea nana, known as dwarf sickle fern, is a fern species in the subfamily Cheilanthoideae of the family Pteridaceae. It grows in eastern Australia, in rainforest or moist eucalyptus forest, often on rocks, cliffs and large boulders. Also found growing on Lord Howe Island. The original specimen was collected by Allan Cunningham at the Brisbane River. In the state of Victoria, this plant is considered rare. The specific epithet nana is derived from the Latin word nanus meaning dwarf (it is a small plant). The fronds are usually 20 to 50 cm long. Each frond has between 25 and 65 leaflets. These pinnae (fern leaflets) have a short stalk or no stalk, oblong to narrow-oblong in shape. Each pinna is 25 mm long and 2.5 to 7 cm wide. The fronds are dark green, paler below. The sori are about 1 mm wide.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology6

Leaf length112 mm

Leaf length max500 mm

Leaf length min200 mm

Leaf width4.75 mm

Leaf width max7 mm

Leaf width min2.5 mm

Life cycle & reproduction4

Dispersal typewind

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formfern

⚠ sources differ — AusTraits: fern · TRY: F

Leaf compoundnesscompound

Leaf shapenarrowly_oblong

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.56 mm²/mg

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pellaea nana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

rbcLMT080340.1 ↗1 255 bp

ACGT

AGATTACCGATTGACCTATTACACTCCCGAATACAAGACCAAAGACACTGATATCTTAGCAGCTTTCCGAATGACCCCCCAACCTGGAGT …

Pellaea nana voucher MELU P118445a ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pellaea nana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 116 n = 58

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 582×CCDB · barker-ferns · CCDB · ipcn-api-dl

CCDB · barker-ferns — Tindale, Mary D., and S. K. Roy. "A cytotaxonomic survey of the Pteridophyta of Australia."Australian Systematic Botany15.6 (2002): 839-937.

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

08Occurrence & distribution

Record type1 834 records

Wild obs. + sensor1 268

Museum / vouchered467

Cultivated / captive1

Other98

Origin

Native117

Introduced1

Range

Area of Occupancy AOO4 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 138≤1 km 43≤10 km 34>10 km 2

1 217 georeferenced · 51 without coordinates

Open the mapobservation + sensor1 268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 109≤1 km 53≤10 km 186>10 km 45

393 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence467

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	156
Mount Annan, AU	120
Museo Entomologico de Leonlocation not on record	52
Canberra, AU	48
Armidale, AU	36
Smithfield, AU	15
Parkville, AU	8
Wellington, NZ	5
John T. Waterhouse Herbariumlocation not on record	5
Adelaide, AU	5
Wollongong, AU	4
Kensington, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Batemans Bay, AU	3
Auckland, NZ	2
James Cook Townsvillelocation not on record	1

16 institutions · 466 of 467 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pellaea nana

At a glance

Sources6 archives

Size & morphology6

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 834 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Record type1 834 records