Pellacalyx axillaris

Korth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Rhizophoraceae/Pellacalyx

At a glance

Occurrence records57

Data sources11

Biological traits20

DNA specimens5

eDNA detections4

Sources11 archives

Databases and archives Pellacalyx axillaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS106 compounds

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Pokok Membuloh Bulu merupakan sejenis tumbuhan yang terdapat di hutan Malaysia serta di negara-negara ASEAN yang lain. Nama botaninya Pellacalyx axillaris Korth.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height20 m

Plant height max24 m

Seed mass0.6 mg

Seed mass max0.6 mg

Seed mass min0.6 mg

Life cycle & reproduction3

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio26.13 g/g

Leaf c478 mg/g

Leaf n18.28 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.32 mm²/mg

Wood density380 mg/cm³

03Chemical composition106 compounds

Compounds documented for Pellacalyx axillaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids $ Isoquinoline alkaloids19

Kaurane and Phyllocladane diterpenoids10

Simple phenolic acids8

Cinnamic acid amides8

Cyclic peptides6

Documented compounds106 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Episyringaresinol	present	NPASS
(+)-Syringaresinol	present	NPASS
(-)-Corydalmine	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(-)-Nornuciferine	present	NPASS
(1S)-1-[(4-hydroxy-3-methoxyphenyl)methyl]-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol	present	NPASS
(1S,4R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyl-tetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4S,5R,9S,10R,13R,14R)-14-(acetyloxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,4S,5R,9S,10R,13R,14R)-14-(dimethoxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pellacalyx axillaris has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences6

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF130325.1 ↗662 bp

ACGT

TCGATGCCTCTGCCCAGCAGAACGACCCGCGAACAAGTTCCATCACACTGAGCCGGGCGTGCGCGGGTCACGGCACCCGCGAGGCCCGCC …

Pellacalyx axillaris internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pellacalyx axillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K. & H. Tobe. 1997. Chromosomes of Carallia, Gynotroches, and Pellacalyx (Rhizophoraceae; Gynotrocheae). Acta Phytotax. Geobot. 48: 15–21.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type57 records

Wild obs. + sensor12

Museum / vouchered45

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 5≤1 km 2≤10 km 1

8 georeferenced · 4 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 45 records without

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	2
LDlocation not on record	1

3 institutions · 8 of 45 vouchered records shown · 37 without an institution code

09Environmental DNA4 detections

Where the DNA of Pellacalyx axillaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)