Pelatantheria scolopendrifolia

(Makino) Aver. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pelatantheria

At a glance

Occurrence records80

Data sources7

Biological traits10

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Pelatantheria scolopendrifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Pelatantheria scolopendrifolia is a species of epiphytic or lithophytic orchid occurring in China, Japan and Korea. The plants closely adhere to the substrate and are creeping. The commonly branched, very slender stem bears distichously arranged, subcylindrical, leathery leaves. One to two widely opening flowers are produced on a short raceme, which is usually shorter than the leaves. The flowers are thinly textured and pale flesh-coloured. The labellum is spurred. Flora of China v 25 p 456, 钻柱兰属 zuan zhu lan shu, Pelatantheria Ridley, J. Linn. Soc., Bot. 32: 371. 1896.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formepiphytic or lithophytic chamaephyte

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelatantheria scolopendrifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP625755.1 ↗693 bpChina · 2023

ACGT

ATTTCGAGACCGAAATTATATCGAGCGATTCGGAGAACCCGTGAAAAATGCGGCGGCGGCCGTCGCCGCGAAGCGGCCGTCCCCGTCGTG …

Pelatantheria scolopendrifolia clone Contig_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor77

Museum / vouchered3

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 8≤1 km 1≤10 km 5>10 km 54

68 georeferenced · 9 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Berlin, DE	1

2 institutions · 3 of 3 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Pelatantheria scolopendrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)