Pelargonium vitifolium

(L.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records282

Data sources11

Biological traits18

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Pelargonium vitifolium's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility282 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS44 compounds

Occurrence & distributionGBIF282 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 88

01Narrative

Pelargonium vitifolium is a species of geranium known by the common name grapeleaf geranium. It is native to South Africa, and it is a commonly grown ornamental plant. This is a mostly erect, branching shrub approaching one meter in maximum height. The stems are soft and coated in soft hairs when young and become more woody with age. The glandular, stiffly-hairy aromatic leaves are about 6 centimeters long and 8 wide, divided into 5 or 7 toothed, heart-shaped lobes. The inflorescence is a dense umbel of several flowers with five petals each around a centimeter long. The flowers are pink with purplish markings.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max180 mm

Leaf width100 mm

Leaf width max100 mm

Leaf width min100 mm

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 799 m

Elevation min610 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub, Forb/herb

Habitat GIFTCoastal

Woodinesswoody

03Chemical composition44 compounds

Compounds documented for Pelargonium vitifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids11

Cadinane sesquiterpenoids5

Oxygenated hydrocarbons3

Fatty alcohols3

Menthane monoterpenoids2

Documented compounds44 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(+)-cis-Isopulegone	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-gamma-Cadinene	present	LOTUS
(R)-1-Octen-3-ol	present	LOTUS
(S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene	present	LOTUS
(±)-2-Heptanol	present	LOTUS
1,7,7-Trimethyltricyclo[2.2.1.02,6]heptane	present	LOTUS
1-Heptanol	present	LOTUS
1-Isopropyl-4-methylbenzene	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium vitifolium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY352894.1 ↗660 bpSouth Africa

ACGT

TTGTCGAATCCTGCACAGCAGTACGACCCGCGAACACGTAACATCAATGGGAAACGGAGGACCCTCGGGCCCGACGTCCCCCACCAAGTC …

Pelargonium vitifolium internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium vitifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 88 n = 44

Ploidypolyploid inferred

Chromosome records88–882n range88median88mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 884×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl — Albers, F. & J. J. A. v. Walt. 1984. Untersuchungen zur Karyologie und Mirosporogenese von Pelargonium sect. Pelargonium (Geraniaceae). Pl. Syst. Evol. 147: 177–188.

CCDB · book-fedorov — Gauger 1937

CCDB · book-atlas-flowering-plants

CCDB · Oberlander2016 — Gauger, 1937 Albers & van der Walt, 1984

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type282 records

Wild obs. + sensor214

Museum / vouchered67

Cultivated / captive1

Origin

Introduced24

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 133≤1 km 42≤10 km 7

182 georeferenced · 32 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 4≤1 km 6≤10 km 6

16 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence67

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	22
Auckland, NZ	9
Christchurch, NZ	4
LDlocation not on record	3
Claremont, US	2
Cape Town, ZA	2
CASlocation not on record	2
Wellington, NZ	2
MeiseBGlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
SLU Artdatabankenlocation not on record	2
Odawara, JP	1
Mexico City, MX	1
MAlocation not on record	1
Cape Town, ZA	1
Philadelphia, US	1
South Kensington, GB	1
Santa Barbara, US	1

18 institutions · 59 of 67 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pelargonium vitifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)