Pelargonium tomentosum

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records270

Data sources9

Biological traits21

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Pelargonium tomentosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Chemical compositionNPASS6 compounds

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT885 Mbp

01Narrative

لقلقي أهلب هو نوع من النباتات يتبع جنس اللقلقي من الفصيلة الغرنوقية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology6

Leaf length max420 mm

Leaf width150 mm

Leaf width max150 mm

Leaf width min150 mm

Plant height max0.75 m

Plant height min0.3 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 220 m

Elevation min122 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: subshrub · TRY: shrub

Habitat GIFTCoastal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: semi_woody · GIFT: non-woody

Physiology & chemistry1

Specific leaf area (SLA)15.87 mm²/mg

03Chemical composition6 compounds

Compounds documented for Pelargonium tomentosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Kaurane and Phyllocladane diterpenoids4

Eudesmane sesquiterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4S,5S,9S,10R,13R)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,4S,5S,9S,10S,13R)-14-formyl-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadec-14-ene-5-carboxylic acid	present	NPASS
[(1S,4S,9S,10R,13R)-5-(acetyloxymethyl)-9-methyl-14-methylidene-5-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]methyl acetate	present	NPASS
ent-Kaur-16-en-19-ol	present	NPASS
JYNWBNNRIMVSAN-GFAIHXBESA-N	present	NPASS
Voleneol	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium tomentosum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJQ479182.1 ↗1 295 bp

ACGT

AAATTGACTTATTATACTCCTGATTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCT …

Pelargonium tomentosum ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Pelargonium tomentosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size885 090 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pelargonium tomentosum0.89 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidy4× tetraploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type270 records

Wild obs. + sensor234

Museum / vouchered33

Cultivated / captive3

Origin

Introduced54

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 99≤1 km 55≤10 km 57

211 georeferenced · 23 without coordinates

Open the mapobservation + sensor234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 3≤10 km 2

5 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence33

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	7
Wellington, NZ	6
Christchurch, NZ	5
Pretoria, ZA	3
Rotorua, NZ	2
Podgorica, ME	1
Riverside, US	1
Porrentruy, CH	1
Kensington, AU	1
MAlocation not on record	1
Cape Town, ZA	1
Saint Louis, US	1
Bern, CH	1
Istituto Agrario Castelnuovolocation not on record	1
Adelaide, AU	1

15 institutions · 33 of 33 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pelargonium tomentosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)