Pelargonium sidoides

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records459

Data sources10

Biological traits15

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Pelargonium sidoides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility459 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS46 compounds

Occurrence & distributionGBIF459 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Pelargonium sidoides is a plant native to South Africa. Its common names include African geranium and South African geranium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.2 m

Life cycle & reproduction3

Life formsubshrub or tuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 700 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition46 compounds

Compounds documented for Pelargonium sidoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple coumarins20

Flavones8

Simple phenolic acids4

Flavan-3-ols3

Guaiane sesquiterpenoids2

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R)-3,5,7-trihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(3S,3aR,4S,9aS,9bS)-4,8-dihydroxy-3,6,9-trimethyl-3,3a,4,5,9a,9b-hexahydroazuleno[4,5-b]furan-2,7-dione	present	LOTUS
(5,6-Dimethoxy-2-oxochromen-7-yl) acetate	present	LOTUS
(6,7-Dihydroxy-2-oxochromen-8-yl) hydrogen sulfate	present	LOTUS
(7,8-Dihydroxy-2-oxochromen-6-yl) hydrogen sulfate	present	LOTUS
2''-O-Galloylisoorientin	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-8-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	LOTUS
5,6,7,8-Tetramethoxycoumarin	present	LOTUS
5,6,7-Trihydroxycoumarin	present	LOTUS
5,6,7-Trimethoxycoumarin	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium sidoides has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

The DNA barcodea real sequence read deposited for this species

ITSMF150990.1 ↗556 bp

ACGT

GGCAGAACGACCCGCGAACACGTTAACATCAAGGGGAACGGAGGACCCTCGGGCCCGACGTCCCCCTCCCGGTCGGCGGCTAAGGCTCAC …

Pelargonium sidoides isolate Psidoidesil 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium sidoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Yu, S. N. & W. A. H. Horn. 1988. Additional chromosome numbers in Pelargonium (Geraniaceae). Pl. Syst. Evol. 159: 165–171.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type459 records

Wild obs. + sensor235

Museum / vouchered223

Cultivated / captive1

Range

Area of Occupancy AOO1 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 147≤1 km 24≤10 km 2>10 km 25

198 georeferenced · 37 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence223

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	177
South African National Biodiversity Institutelocation not on record	12
Cape Town, ZA	10
Durban, ZA	7
Cape Town, ZA	5
Denver, US	3
Kew, GB	2
Bangkok, TH	1
LDlocation not on record	1
Bronx, US	1
Zürich, CH	1

11 institutions · 220 of 223 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)