Pelargonium quercifolium

(L.fil.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records198

Data sources11

Biological traits31

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Pelargonium quercifolium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionNPASS2 compounds

Occurrence & distributionGBIF198 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT841 Mbp

01Narrative

لقلقي بلوطي الأوراق هو نوع من النباتات يتبع جنس اللقلقي من الفصيلة الغرنوقية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Fruit length18 mm

Leaf length65 mm

Leaf width72.5 mm

Petiole length4.5 cm

Plant height max1.8 m

Plant height min0.5 m

Seed mass4.76 mg

Seed mass max4.76 mg

Seed mass min4.76 mg

Life cycle & reproduction8

Flower colourpink

Flower length max25 mm

Flower length min20 mm

Flowering endDec

Flowering startJan

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 100 m

Elevation min61 m

Epiphyteterrestrial

Fruit typemericarp

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: subshrub · TRY: Shrub

Leaf formpinnate

Leaf shapecordate triangular

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: semi_woody · GIFT: woody

Other traits2

Inflorescenceumbel

Shoot orientationerect

03Chemical composition2 compounds

Compounds documented for Pelargonium quercifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Tropane alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
STECJAGHUSJQJN-FWXGHANASA-N		present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium quercifolium has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY352890.1 ↗620 bpSouth Africa

ACGT

CACGTTAACATCAGGGGGAACGGAGGACCCTCGGCCCGACGTCCCCCACCAAGTCGGCGGCTAAGGCTACGCCTGCGTCCCGACAACAAC …

Pelargonium quercifolium internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Pelargonium quercifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size841 080 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pelargonium quercifolium0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidy4× tetraploid · measured

Chromosome records44–882n range44median44mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 445×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Albers, F. & J. J. A. v. Walt. 1984. Untersuchungen zur Karyologie und Mirosporogenese von Pelargonium sect. Pelargonium (Geraniaceae). Pl. Syst. Evol. 147: 177–188.

CCDB · book-ipcn73-74 — TOKUMASU, S., M. KATO, & F. YANO. 1974. Presumptive crossaffinity relationship among Pelargoniurn species through the observation of pollen tube behavior by means of the fluorescence microscope. Jap. J. Breed. 24(6): 269-276.

CCDB · kew — Weng M-L, Ruhlman TA, Gibby M, Jansen RK. 2012. Phylogeny, rate variation, and genome size evolution of Pelargonium (Geraniaceae). Molecular Phylogenetics and Evolution. 64: 654-670.

CCDB · Oberlander2016 — Knicely, 1964;Albers & van der Walt, 1984 Gauger, 1937

2n 452×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Takagi, F. 1928

CCDB · book-fedorov — Takagi 1928b

2n 881×CCDB · Oberlander2016

CCDB · Oberlander2016 — Knicely, 1964;Albers & van der Walt, 1984 Gauger, 1937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type198 records

Wild obs. + sensor134

Museum / vouchered64

Origin

Native1

Introduced12

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 96≤1 km 10≤10 km 7>10 km 3

116 georeferenced · 18 without coordinates

Open the mapobservation + sensor134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 8≤1 km 10≤10 km 3

21 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	28
Adelaide, AU	6
Museo Entomologico de Leonlocation not on record	5
Auckland, NZ	5
Mount Annan, AU	3
Canberra, AU	3
Armidale, AU	2
Podgorica, ME	1
Riverside, US	1
Cape Town, ZA	1
Bronx, US	1
GHPG$location not on record	1
MAlocation not on record	1
Parkville, AU	1
Canadian Department of Agriculturelocation not on record	1
Saint Louis, US	1
MeiseBGlocation not on record	1
San Luis Obispo, US	1
València, ES	1

19 institutions · 64 of 64 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pelargonium quercifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)