Pelargonium odoratissimum

(L.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records358

Data sources9

Biological traits17

DNA specimens1

eDNA detections2

Sources9 archives

Databases and archives Pelargonium odoratissimum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF358 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Pelargonium odoratissimum ( L'Hér., 1789) è una pianta appartenente alla famiglia delle Geraniaceae, originaria di Sudafrica ed eSwatini.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.2 m

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 517 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Shrub

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium odoratissimum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE795072.1 ↗655 bpSouth Africa

ACGT

TCGAATCCTGCACGGCAGAACGACCCGCGAACACGTTAACATCTAGGGGGACGGAGGACCCTCGGGCCCGAAGCCCCCCTCCAAGTCGGC …

Pelargonium odoratissimum genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, specimen voucher M. Weigend 9299

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium odoratissimum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +1

CCDB · ipcn-api-dl — Dreyer, L. L., F. Albers, J. J. A. v. Walt & D. E. Murschewski. 1992. Subdivision of Pelargonium sect. Cortusina (Geraniaceae). Pl. Syst. Evol. 183: 83–97.

CCDB · book-indian_vol1 — Takagi, F. 1928

CCDB · book-fedorov — Takagi 1928b

CCDB · book-atlas-flowering-plants — Takagi 1928

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type358 records

Wild obs. + sensor226

Museum / vouchered130

Cultivated / captive2

Origin

Native1

Introduced52

Range

Area of Occupancy AOO864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 106≤1 km 64≤10 km 4>10 km 15

189 georeferenced · 37 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 2≤1 km 7≤10 km 6>10 km 1

16 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence130

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	67
UTPLlocation not on record	10
Universidad de Antioquia (UdeA)location not on record	5
Loja, EC	5
UFOPlocation not on record	5
Cape Town, ZA	3
Auckland, NZ	3
Universidad de Caldas (UCaldas)location not on record	3
València, ES	2
Linares, MX	2
Saint Louis, US	2
MAlocation not on record	2
Salvador, BR	2
Durban, ZA	2
Northridge, US	1
Riobamba, EC	1
Universidade Federal de Santa Catarinalocation not on record	1
University of Johannesburglocation not on record	1
Alicante, ES	1
Christchurch, NZ	1
Paris, FR	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
UIBlocation not on record	1
Universidad de La Salle (La Salle)location not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
UnBlocation not on record	1
Riverside, US	1
Universidad Industrial de Santander (UIS)location not on record	1

28 institutions · 127 of 130 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pelargonium odoratissimum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter6.60 °C

Max temp (day)21.2 °C

Min temp (night)14.4 °C

Precipitation50.1 mm/mo

Air humidity59.7 %

Moisture balance-94.4 mm/mo

Vapour deficit816 Pa

Wind speed4.90 m/s

Cloud cover21.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)