Pelargonium luridum

(Andrews) Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records2 207

Data sources12

Biological traits15

DNA specimens7

eDNA detections7

Sources12 archives

Databases and archives Pelargonium luridum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF2 207 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2.5 Gbp

01Narrative

Pelargonium luridum, locally called variable stork's bill, is a medium high, tuberous herbaceous perennial geophyte, belonging to the Stork's bill family, with white to pink, slightly mirror symmetrical flowers in umbels on long unbranched stalks directly from the ground rosette that consists of few initially ovate, later pinnately incised or linear leaves, with blunt teeth around the margin. The variable stork's bill naturally occurs from South Africa to Angola, southern Congo and Tanzania.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.7 m

Plant height max1 m

Plant height min0.8 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 440 m

Elevation min10 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium luridum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

The DNA barcodea real sequence read deposited for this species

ITSAF256560.1 ↗658 bp

ACGT

AACACGTTAACATCAAGGGGTGCGGAGGACCCTCGGGCCCGACGTCCCCCACCCGGTCGGTGGCTAAGGCTACGCCCGCGTCCCGACTAA …

Pelargonium luridum 63 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium luridum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 484 120 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pelargonium luridum2.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DAKER, M.G. 1969. Chromosome numbers of Pelargonium species and cultivars. J. Roy. Hort. Soc. 94: 346 353.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 207 records

Wild obs. + sensor1 443

Museum / vouchered762

Cultivated / captive2

Range

Area of Occupancy AOO4 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 859≤1 km 188≤10 km 58>10 km 37

1 142 georeferenced · 301 without coordinates

Open the mapobservation + sensor1 443

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤1 km 6≤10 km 3>10 km 2

11 georeferenced · 751 without coordinates

Open the institutions mapphysical evidence762

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	478
Durban, ZA	180
Adam Mickiewicz University in Poznańlocation not on record	12
LNBG$location not on record	9
Zürich, CH	8
Instituto de Investigação Científica Tropicallocation not on record	8
Kew, GB	7
Saint Louis, US	6
MeiseBGlocation not on record	6
Frankfurt am Main	3
TAFORI-LSRClocation not on record	2
Cape Town, ZA	2
Cape Town, ZA	2
University of Stellenboschlocation not on record	1
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	1

15 institutions · 725 of 762 vouchered records shown · 37 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Pelargonium luridum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pelargonium luridum

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 207 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 207 records