Pelargonium grossularioides

(L.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records1 518

Data sources10

Biological traits19

DNA specimens9

eDNA detections7

Sources10 archives

Databases and archives Pelargonium grossularioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 518 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF1 518 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB885 Mbp

01Narrative

Pelargonium grossularioides is a species of geranium known by the common names gooseberry geranium and coconut geranium. It is native to southern Africa and it is known in coastal California and parts of India as an introduced species. It is sometimes grown as a garden geranium. This is a glandular, aromatic perennial herb with an erect, angular, reddish stem 20 to 50 centimeters tall. The green to reddish leaves are a few centimeters long and slightly lobed with toothed edges. The inflorescence is an umbel of 3 to 50 flowers in shades of light pink to dark reddish purple. There are five narrow petals no more than 6 millimeters long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.2 m

Plant height min0.05 m

Seed mass0.5 mg

⚠ sources differ — TRY: 0.5 mg · GIFT: 0.47 mg

Seed mass max0.47 mg

Seed mass min0.47 mg

Life cycle & reproduction3

Life formannual or perennial

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 795 m

Elevation min6 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Herbaceous Dicot

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Leaf n14.47 mg/g

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium grossularioides has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences7

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK670424.1 ↗2 446 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Pelargonium grossularioides voucher Mao-Lun Weng G1013 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium grossularioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size885 090 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pelargonium grossularioides0.89 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DAKER, M.G. 1969. Chromosome numbers of Pelargonium species and cultivars. J. Roy. Hort. Soc. 94: 346 353.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 518 records

Wild obs. + sensor1 109

Museum / vouchered409

Origin

Introduced35

Range

Area of Occupancy AOO2 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 837≤1 km 98≤10 km 13>10 km 13

961 georeferenced · 148 without coordinates

Open the mapobservation + sensor1 109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 10≤1 km 40≤10 km 18

68 georeferenced · 341 without coordinates

Open the institutions mapphysical evidence409

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	130
Cape Town, ZA	88
Durban, ZA	20
San Luis Obispo, US	16
Santa Barbara, US	15
Riverside, US	13
Canadian Department of Agriculturelocation not on record	12
Davis, US	9
San Diego, US	9
Claremont, US	7
Saint Louis, US	6
MSB-3054location not on record	5
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	5
Irvine, US	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
South African National Biodiversity Institutelocation not on record	3
Kew, GB	3
GHPG$location not on record	3
Philadelphia, US	3
MeiseBGlocation not on record	3
Vancouver, CA	3
Pondicherry, IN	3
Auckland, NZ	2
Corvallis, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Santa Cruz, US	2
Istituto Agrario Castelnuovolocation not on record	2
CASlocation not on record	1
EL PASO, US	1
Arcata, US	1
MAlocation not on record	1
Provo, US	1
Olocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
San Diego Natural History Museumlocation not on record	1
Bloomington, US	1
Bangkok, TH	1
LDlocation not on record	1
LNBG$location not on record	1

39 institutions · 386 of 409 vouchered records shown · 23 without an institution code

09Environmental DNA7 detections

Where the DNA of Pelargonium grossularioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pelargonium grossularioides

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 518 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 518 records