Pelargonium fragrans

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records28

Data sources6

Biological traits12

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Pelargonium fragrans's data was compiled from.

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources12 traits

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesAusTraits

Size & morphology4

Leaf length25 mm

Leaf width30 mm

Petiole length5 cm

Plant height0.5 m

Life cycle & reproduction3

Flowering timeyynnnnnnnnny

Life spanperennial

Sex typehermaphrodite

Habitat & environment5

Fruit typemericarp

Growth formsubshrub

Leaf compoundnesssimple

Leaf shapewidely_ovate

Woodinesssemi-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium fragrans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK670380.1 ↗2 434 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Pelargonium fragrans voucher van de Kerke 19895003IPEN small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor5

Museum / vouchered23

Origin

Introduced3

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 1≤1 km 7≤10 km 2>10 km 1

11 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	3
Auckland, NZ	3
Christchurch, NZ	3
LDlocation not on record	3
Mount Annan, AU	2
Brisbane, AU	1
San Luis Obispo, US	1
Canadian Department of Agriculturelocation not on record	1
València, ES	1
Adelaide, AU	1
Rotorua, NZ	1
Istituto Agrario Castelnuovolocation not on record	1

12 institutions · 21 of 23 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Pelargonium fragrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)