Pelargonium cucullatum

(L.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records2 480

Data sources9

Biological traits19

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Pelargonium cucullatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 480 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF2 480 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Le Pelargonium cucullatum, ou pélargonium à feuilles en entonnoir est arbrisseau de la famille des Geraniaceae, croissant en Afrique du Sud. Par hybridation avec d'autres pélargoniums, P. cucullatum a permis de dériver le groupe regal de pélargoniums horticoles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max2 m

Plant height min0.4 m

Seed mass4.2 mg

Seed mass max4.44 mg

Seed mass min3.89 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation min6 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Herbaceous Dicot

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Leaf n15.2 mg/g

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium cucullatum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF256569.1 ↗587 bp

ACGT

AACACGTTAACATCAAGGGGAAACGGAGGACCCTCGGGCCCGACGTCCCCCACCAAGTCGGTGGCTAAGGCTACGCCTGCGTCCCGACGA …

Pelargonium cucullatum 72b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium cucullatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 227×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · kew +1

CCDB · ipcn-api-dl — Motohashi, T. & M. Amano. 1986. Chromosome numbers of the genus Pelargonium (preliminary report). Sci. Rep. Res. Inst. Evol. Biol. 3: 157–170.

CCDB · ipcn-api-dl — Yu, S. N. & W. A. H. Horn. 1988. Additional chromosome numbers in Pelargonium (Geraniaceae). Pl. Syst. Evol. 159: 165–171.

CCDB · book-ipcn67-71 — DAKER, M.G. 1969. Chromosome numbers of Pelargonium species and cultivars. J. Roy. Hort. Soc. 94: 346 353.

CCDB · kew — Weng M-L, Ruhlman TA, Gibby M, Jansen RK. 2012. Phylogeny, rate variation, and genome size evolution of Pelargonium (Geraniaceae). Molecular Phylogenetics and Evolution. 64: 654-670.

CCDB · Oberlander2016 — Yu & Horn, 1988

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 480 records

Wild obs. + sensor2 446

Museum / vouchered33

Cultivated / captive1

Range

Area of Occupancy AOO1 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 751≤1 km 273≤10 km 60>10 km 24

2 108 georeferenced · 338 without coordinates

Open the mapobservation + sensor2 446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 4≤1 km 8≤10 km 2

14 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence33

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	5
Cape Town, ZA	3
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	3
University of Johannesburglocation not on record	2
Museo Entomologico de Leonlocation not on record	2
Pretoria, ZA	2
Auckland, NZ	2
Bronx, US	1
Boise, US	1
Barcelona, ES	1
Paris, FR	1
Turlock, US	1
Wlocation not on record	1
Saint Louis, US	1
Jackson, US	1
Adam Mickiewicz University in Poznańlocation not on record	1

16 institutions · 28 of 33 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Pelargonium cucullatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 13.7–17.8

Seasonal swing summer↔winter7.20 °C

Max temp (day)19.0 °C 15.4–21.8

Min temp (night)11.9 °C 11.0–15.8

Precipitation118 mm/mo 44.5–143

Air humidity62.2 % 58.4–62.6

Moisture balance34.9 mm/mo

Vapour deficit773 Pa 592–829

Wind speed6.20 m/s

Cloud cover12.9 % 9.20–13.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pelargonium cucullatum

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction2

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 480 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 480 records