Pelargonium cordifolium

(Cav.) Curtis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records744

Data sources6

Biological traits16

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pelargonium cordifolium's data was compiled from.

GBIFGlobal Biodiversity Information Facility744 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF744 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max1.5 m

Plant height min1 m

Seed mass2.72 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 220 m

Elevation min91 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Herbaceous Dicot

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Leaf n12.14 mg/g

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium cordifolium has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSMK670358.1 ↗5 842 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Pelargonium cordifolium voucher Connecticut 255986 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium cordifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · Oberlander2016

CCDB · ipcn-api-dl — Albers, F. & J. J. A. v. Walt. 1984. Untersuchungen zur Karyologie und Mirosporogenese von Pelargonium sect. Pelargonium (Geraniaceae). Pl. Syst. Evol. 147: 177–188.

CCDB · ipcn-api-dl — Yu, S. N. & W. A. H. Horn. 1988. Additional chromosome numbers in Pelargonium (Geraniaceae). Pl. Syst. Evol. 159: 165–171.

CCDB · Oberlander2016 — Yu & Horn, 1988

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type744 records

Wild obs. + sensor644

Museum / vouchered100

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 496≤1 km 47≤10 km 19>10 km 7

569 georeferenced · 75 without coordinates

Open the mapobservation + sensor644

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 2≤1 km 4≤10 km 1

7 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	85
Cape Town, ZA	2
MeiseBGlocation not on record	2
Auckland, NZ	2
Denver, US	1
Ivano-Frankivsk, UA	1
MSB-3054location not on record	1
Bloomington, US	1
South Kensington, GB	1
LDlocation not on record	1

10 institutions · 97 of 100 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)