Pelargonium capitatum

(L.) L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Pelargonium

At a glance

Occurrence records6 854

Data sources10

Biological traits53

DNA specimens6

eDNA detections5

Sources10 archives

Databases and archives Pelargonium capitatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 854 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources53 traits

Chemical compositionNPASS13 compounds

Occurrence & distributionGBIF6 854 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 66

01Narrative

Pelargonium capitatum, le pélargonium à fleurs en tête est une espèce de plantes de la famille des Geraniaceae, croissant sur les côtes d'Afrique du Sud. Elle est cultivée comme plante d'ornement et ses hybrides donnent des plantes aromatiques cultivées pour leurs huiles essentielles à odeur de rose.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology15

Fruit length16 mm

Leaf length50 mm

Leaf length max80 mm

Leaf length min20 mm

Leaf mass per area64.44 g/m2

Leaf width50 mm

Leaf width max80 mm

Leaf width min20 mm

Petiole length4 cm

Plant height1 m

Plant height max1 m

Plant height min0.1 m

Seed mass3.92 mg

Seed mass max4.75 mg

Seed mass min3.1 mg

Life cycle & reproduction16

Dispersal typeunspecialized

Flower colourpink

Flower length max20 mm

Flower length min10 mm

Flowering endDec

Flowering startJan

Flowering timennnnnnnnyyyn

Life formsubshrub or shrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment15

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation mean2 620 m

Elevation min1 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb · TRY: H

Leaf compoundnesssimple

Leaf formorbicular

Leaf shapecordate ovate

Mycorrhiza typearbuscular

Woodinessvariable

⚠ sources differ — TRY: variable · AusTraits: herbaceous · GIFT: variable

Physiology & chemistry4

Leaf n21.0 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.54 mm²/mg

Other traits2

Seeds per fruit0

Shoot orientationerect

03Chemical composition13 compounds

Compounds documented for Pelargonium capitatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aristolane sesquiterpenoids6

Gorgonane sesquiterpenoids3

Eudesmane sesquiterpenoids $ Gorgonane sesquiterpenoids1

Bisabolane sesquiterpenoids1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(4beta,5beta,6beta,7beta)-Aristol-9-en-8-one	present	NPASS
5-isothiocyanato [C16H25N]	present	NPASS
[(2R)-6-methyl-2-[(1R)-4-methylcyclohex-3-en-1-yl]hept-5-en-2-yl] thiocyanate	present	NPASS
Acanthene B	present	NPASS
AUJRLJBMOPBACN-WKILWMFISA-N	present	NPASS
Axinisothiocyanate M	present	NPASS
Axinisothiocyanate N	present	NPASS
Axinynitrile A	present	NPASS
Axinysone A	present	NPASS
Axinysone B	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelargonium capitatum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences7

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK670407.1 ↗5 842 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Pelargonium capitatum voucher Mao-Lun Weng G1058 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL4★rbcLa★ITS1

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pelargonium capitatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Ploidypolyploid inferred

Chromosome records66–662n range66median66mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 665×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Motohashi, T. & M. Amano. 1986. Chromosome numbers of the genus Pelargonium (preliminary report). Sci. Rep. Res. Inst. Evol. Biol. 3: 157–170.

CCDB · ipcn-api-dl — Albers, F. & J. J. A. v. Walt. 1984. Untersuchungen zur Karyologie und Mirosporogenese von Pelargonium sect. Pelargonium (Geraniaceae). Pl. Syst. Evol. 147: 177–188.

CCDB · ipcn-api-dl — Yu, S. N. & W. A. H. Horn. 1988. Additional chromosome numbers in Pelargonium (Geraniaceae). Pl. Syst. Evol. 159: 165–171.

CCDB · book-ipcn67-71 — DAKER, M.G. 1969. Chromosome numbers of Pelargonium species and cultivars. J. Roy. Hort. Soc. 94: 346 353.

CCDB · book-indian_vol1 — Daker, M.G. 1969

2n 771×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Demarne, F. & J. J. A. van/der/Walt. 1989. Origin of the rose-scented Pelargonium cultivar grown on Réunion Island. S. African J. Bot. 55: 184–191.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 854 records

Wild obs. + sensor6 440

Museum / vouchered412

Cultivated / captive2

Origin

Native9

Introduced47

Range

Area of Occupancy AOO6 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 4 573≤1 km 713≤10 km 174>10 km 70

5 530 georeferenced · 910 without coordinates

Open the mapobservation + sensor6 440

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 29≤1 km 16≤10 km 92>10 km 5

142 georeferenced · 270 without coordinates

Open the institutions mapphysical evidence412

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	133
Kensington, AU	86
Durban, ZA	40
Mount Annan, AU	22
Canberra, AU	18
Museo Entomologico de Leonlocation not on record	16
Cape Town, ZA	7
Brisbane, AU	6
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	6
Auckland, NZ	6
MSB-3054location not on record	6
Hobart, AU	6
GHPG$location not on record	6
South African National Biodiversity Institutelocation not on record	5
Adelaide, AU	4
Kew, GB	4
Arcata, US	3
BGPAlocation not on record	3
Riverside, US	2
Bronx, US	2
University of Johannesburglocation not on record	2
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
Northridge, US	1
Philadelphia, US	1
John T. Waterhouse Herbariumlocation not on record	1
Claremont, US	1
Davis, US	1
Barcelona, ES	1
Stockholm, SE	1
Saint Louis, US	1
UNICAMPlocation not on record	1
GB	1
Armidale, AU	1
Canadian Department of Agriculturelocation not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Rotorua, NZ	1
Los Angeles, US	1
LDlocation not on record	1
MAlocation not on record	1
Parkville, AU	1

40 institutions · 402 of 412 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Pelargonium capitatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.4–18.5

Seasonal swing summer↔winter10.9 °C

Max temp (day)20.5 °C 19.4–21.2

Min temp (night)13.2 °C 10.4–16.5

Precipitation48.2 mm/mo 19.6–70.4

Air humidity59.2 % 57.7–61.7

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa 782–838

Wind speed4.60 m/s

Cloud cover24.9 % 8.40–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pelargonium capitatum

At a glance

Sources10 archives

Size & morphology15

Life cycle & reproduction16

Diet & foraging1

Habitat & environment15

Physiology & chemistry4

Other traits2

Compound class profile4 classes

Documented compounds13 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 854 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 854 records