Pelagodoxa henryana

Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Pelagodoxa

At a glance

Occurrence records23

Data sources9

Biological traits31

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Pelagodoxa henryana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

giftgenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGIFT2n = 32

01Narrative

Pelagodoxa henryana est une espèce de la famille des Arecaceae (palmiers). Elle est endémique des îles Marquises en Polynésie française. C'est une des deux espèces actuellement acceptées dans le genre Pelagodoxa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length125 mm

Fruit width85 mm

Fruit width max150 mm

Fruit width min20 mm

Leaf length max3 500 mm

Leaf length min3 000 mm

Leaf width max1 000 mm

Leaf width min900 mm

Plant height11 m

Plant height max11 m

Life cycle & reproduction4

Flower width max300 mm

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit colourbrown

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits7

Dbh max15 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Seeds per fruit1-10

Shoot length max1 100 cm

Shoot orientationerect

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pelagodoxa henryana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692336.1 ↗486 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Pelagodoxa henryana voucher XTBG238 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceGIFT

The complete instruction manual Pelagodoxa henryana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×GIFT · GIFT (floras)

GIFT · GIFT (floras)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type23 records

Wild obs. + sensor4

Museum / vouchered18

Other1

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	6
Saint Louis, US	4
Bronx, US	2
Xiamen, CN	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
ASUlocation not on record	1
Gump Stationlocation not on record	1

7 institutions · 16 of 18 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Pelagodoxa henryana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)