Pediocactus simpsonii

(Engelm.) Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pediocactus

At a glance

Occurrence records4 960

Data sources9

Biological traits12

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Pediocactus simpsonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 960 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF4 960 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Pediocactus simpsonii subsp. idahoensis ist eine Unterart der Pflanzenart Pediocactus in der Familie der Kakteengewächse (Cactaceae). Das Artepitheton bezieht sich auf das Hauptvorkommen im Kartoffelstaat Idaho. Englische Trivialnamen sind „Caespitose Cactus“ und „Idaho Cactus“.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.02 mg

Seed mass max2.02 mg

Seed mass min2.02 mg

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pediocactus simpsonii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMK449106.1 ↗510 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Pediocactus simpsonii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pediocactus simpsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Reveal, J. L. & R. Spellenberg. 1976. Miscellaneous chromosome counts of Western American plants - III. Rhodora 78: 37–52.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 960 records

Wild obs. + sensor4 818

Museum / vouchered140

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO9 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 763≤1 km 361≤10 km 225>10 km 651

4 000 georeferenced · 818 without coordinates

Open the mapobservation + sensor4 818

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 5≤1 km 25≤10 km 18>10 km 4

52 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence140

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee des Dinosaures d'Esperaza (Aude)location not on record	21
Bronx, US	13
Denver, US	12
Logan, US	11
Moscow, US	9
Orem, US	8
DOI/NPS, Colonial National Historical Parklocation not on record	6
Missoula, US	5
Boise, US	5
Pocatello, US	5
St. Paul, US	5
Provo, US	4
ASUlocation not on record	4
WTUlocation not on record	4
Claremont, US	4
Philadelphia, US	4
Wuzhou, CN	3
Bandelier National Monumentlocation not on record	3
Bozeman, US	3
Albuquerque, US	2
Flagstaff, US	1
Chadron, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Caldwell, US	1
Phoenix, US	1
Vancouver, CA	1
Austin, US	1
Pacific Lutheran Universitylocation not on record	1
Bloomington, US	1

29 institutions · 140 of 140 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pediocactus simpsonii

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 960 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 29 geolocated

Cultivated / Captivenot free-living

Record type4 960 records