Pedicularis verticillata
speciesAt a glance
Occurrence records22 760
Data sources13
Biological traits34
DNA specimens44
eDNA detections29
Sources13 archives
Databases and archives Pedicularis verticillata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 760 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Chemical compositionLOTUS14 compounds
Occurrence & distributionGBIF22 760 records
Environmental DNA1 datasets · 6 countries29 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB2n = 12
01Narrative
La pédiculaire verticillée, ou herbe à poux, est une espèce de plantes à fleurs de la famille des Scrophulariaceae selon la classification classique de Cronquist (1981) ou des Orobanchaceae selon la classification APG III. C'est une plante herbacée vivace.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf size105 mm²
Leaf width15 mm
Leaf width max18 mm
Leaf width min12 mm
Plant height0.15 m
⚠ sources differ — GIFT: 0.15 m · LEDA: 0.15 m · TRY: 0.08 m
Plant height generative0.123 m
Plant height max0.15 m
Plant height min0.05 m
Seed length2.25 mm
Seed mass0.63 mg
Life cycle & reproduction10
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
Flowering endAug
Flowering startJun
Life formhemiparasitic annual
Life spanperennial
Lifespan years3 years
Raunkiær life formVascular semi-parasite
⚠ sources differ — LEDA: Vascular semi-parasite · GIFT: hemicryptophyte
Seed number27 440
Sex typehermaphrodite
Diet & foraging1
Parasiteobligatory
Habitat & environment8
Aquaticterrestrial
Climatesubalpine or subarctic
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTmeadows, mountains, stony places, tundra
Mycorrhiza type0.911691328
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)168 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.24 mm²/mg
Other traits1
Diaspore typeseed
03Chemical composition14 compounds
Compounds documented for Pedicularis verticillata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Iridoids monoterpenoids8
Cinnamic acids and derivatives $ Phenylethanoids3
Neolignans2
Flavonols1
Documented compounds14 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3R,4R,5S,6R)-2-(hydroxymethyl)-6-[4-[(2R,3R)-3-(hydroxymethyl)-7-[(E)-3-hydroxyprop-1-enyl]-5-methoxy-2,3-dihydro-1,4-benzodioxin-2-yl]-2-methoxyphenoxy]oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5S,6R)-2-(hydroxymethyl)-6-[4-[(2S,3R)-3-(hydroxymethyl)-7-[(E)-3-hydroxyprop-1-enyl]-5-methoxy-2,3-dihydro-1,4-benzodioxin-2-yl]-2-methoxyphenoxy]oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(2R,3S,4S,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-3,7-dihydroxy-4-oxochromen-5-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3,5-dihydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| 8-Epideoxyloganic acid | present | LOTUS | |
| 8-Epiloganic Acid | present | LOTUS | |
| Aucubin | present | LOTUS | |
| Boschnaloside | present | LOTUS | |
| Caryptoside | present | LOTUS | |
| Cistanoside C | present | LOTUS | |
| Cistanoside D | present | LOTUS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis verticillata has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes8
GenBank sequences10
eDNA detections29
Countries7
The DNA barcodea real sequence read deposited for this species
TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCTCCA …
Pedicularis verticillata isolate LLV55 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Pedicularis verticillata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records12–162n range12median12mode34records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1230×CCDB · slov-fl · CCDB · iber-fl · CCDB · fl-europaea +11
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iber-fl — Nouvelles prospections caryologiques dans la flore orophile des Pyrnes et de la Sierra Nevada. Kpfer, P.Bull. Soc. Neuchteloise Sci. Nat.91: 87-104(1968).
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · fl-europaea — Ktlpfer, 1968
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Andreev, V. N. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 575–576.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · book-ipcn66 — Zhukova1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.
CCDB · book-ipcn75-78 — Hurin 1978
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · book-indian_vol1 — Favarger, C. 1953, 1965; Zhukova, P.G. (Fedorov); Johnson, A.W. & Packer, J.G. 1968 ; Sokolovskaya, A.P. 1968; Taylor, R.L. & Mulligan, G.A. 1968 ; Favarger, C. 1969b
CCDB · book-fedorov — Favarger 1953, 1965a lKyxoua 1966
CCDB · book-atlas-flowering-plants — Favarger 1953
CCDB · CromoCat 2015 — Andreev, N. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 575-576.
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E. & Dobeš, C. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienn
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976a). Rol poliploidii v genesise flory Putorana. In: Flora Putorana, NS.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1978a). Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19-48. Nauka, Novosibirsk.
CCDB · CromoCat 2015 — Küpfer, P. (1968). Nouvelles prospections caryologiques dans la flore orophile des Pyrénées et de la Sierra Nevada. Bull. Soc. Neuchât. Sci. Nat. 91: 87-104.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
CCDB · iapt — IAPT/IOPB Chromosome Data 33
2n 164×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · ipcn-api-dl — Huang, R. f., S. d. Shen & X. f. Lu. 1996. Studies on the chromosome number and polyploidy for a number of plants in the north-east Qinghai-Xizang Plateau. Acta Bot. Boreal.-Occid. Sin. 16(3): 310–318.
CCDB · CromoCat 2015 — Huang, R.-F., Shen, S-D. & Lu, X.-F. (1996). Studies on the chromosome number and polyploidy for a number of plants in the north-east Qingai-Xizang Plateau Acta Bot. Boreal.-Occi. Sin. 16(3):310-318
CCDB · CromoCat 2015 — Probatova, N. S., Rudyka, E. G., Seledets, V. P. & Nechaev, V. A. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
n 64×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015 +1
CCDB · iber-fl — Nouvelles prospections caryologiques dans la flore orophile des Pyrnes et de la Sierra Nevada. Kpfer, P.Bull. Soc. Neuchteloise Sci. Nat.91: 87-104(1968).
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Küpfer, P. (1968). Nouvelles prospections caryologiques dans la flore orophile des Pyrénées et de la Sierra Nevada. Bull. Soc. Neuchât. Sci. Nat. 91: 87-104.
CCDB · iapt — IAPT/IOPB Chromosome Data 33
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type22 760 records
Wild obs. + sensor20 050
Museum / vouchered2 013
Cultivated / captive1
Other696
Origin
Native13
Range
Area of Occupancy AOO23 908 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy37% within 1 km
≤100 m 4 539≤1 km 1 498≤10 km 9 731>10 km 690
16 458 georeferenced · 3 592 without coordinates
Open the mapobservation + sensor20 050
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 55≤1 km 194≤10 km 444>10 km 66
759 georeferenced · 1 254 without coordinates
Open the institutions mapphysical evidence2 013
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions78 of 157 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 265 |
| GJOlocation not on record | 125 |
| Uniwersytet Wrocławskilocation not on record | 91 |
| Beijing, CN | 74 |
| Salzburg, AT | 68 |
| BFLlocation not on record | 50 |
| Mlocation not on record | 48 |
| Adam Mickiewicz University in Poznańlocation not on record | 47 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 44 |
| LDlocation not on record | 44 |
| Zürich, CH | 36 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 34 |
| Zürich, CH | 31 |
| Yangling, CN | 30 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 29 |
| Barcelona, ES | 28 |
| Shinshu Universitylocation not on record | 28 |
| Bern, CH | 27 |
| Xining, CN | 25 |
| BClocation not on record | 25 |
| Entomological Society of Latvialocation not on record | 24 |
| Oskarshamn, SE | 24 |
| Urumqi, CN | 23 |
| Toyama, JP | 20 |
| Provincia di Livornolocation not on record | 20 |
| Victoria, CA | 19 |
| Anchorage, US | 19 |
| Tsukuba, JP | 18 |
| Taipei, TW | 18 |
| Yukon Universitylocation not on record | 17 |
| Vancouver, CA | 17 |
| University of Stellenboschlocation not on record | 15 |
| Taipei, TW | 15 |
| Odawara, JP | 14 |
| TAIElocation not on record | 13 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 13 |
| BRNUlocation not on record | 13 |
| WTUlocation not on record | 13 |
| Inner Mongolia Universitylocation not on record | 12 |
| Omachi Alpine Museumlocation not on record | 12 |
| Glarus, CH | 11 |
| Kunming, CN | 11 |
| Porrentruy, CH | 11 |
| Kyoto Universitylocation not on record | 10 |
| Cambridge, US | 10 |
| Wlocation not on record | 10 |
| Sant Julià de Lòria, AD | 10 |
| Tomioka, JP | 10 |
| SNSNMClocation not on record | 9 |
| LfUlocation not on record | 9 |
| València, ES | 9 |
| Kandalaksha State Nature Reservelocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| BDBClocation not on record | 8 |
| Salamanca, ES | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 8 |
| Whitehorse, CA | 8 |
| Chongqing Museumlocation not on record | 8 |
| Olocation not on record | 8 |
| SZUlocation not on record | 8 |
| MAlocation not on record | 7 |
| SXTCMlocation not on record | 7 |
| Sanda, JP | 6 |
| Chicago, US | 6 |
| Granada, ES | 5 |
| Kew, GB | 5 |
| Wuzhou, CN | 5 |
| Hebei Normal Universitylocation not on record | 5 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 5 |
| Northeastern Forestry Universitylocation not on record | 5 |
| Nagano City, JP | 5 |
| Cambridge, US | 5 |
| Madrid, ES | 5 |
| Sion, CH | 5 |
| WNNUlocation not on record | 4 |
| Xian, CN | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Frankfurt am Main | 4 |
| Provo, US | 4 |
| GZUlocation not on record | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| Taiyuan Normal Universitylocation not on record | 3 |
| Bourges, FR | 3 |
| Fort Worth, US | 3 |
| MeiseBGlocation not on record | 3 |
| Lanzhou, CN | 3 |
| Vitoria, ES | 3 |
| Chengdu, CN | 3 |
| University of Salzburglocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| San Sebastián, ES | 3 |
| Edinburgh, GB | 3 |
| Jiangxi College of Educationlocation not on record | 2 |
| Paris, FR | 2 |
| FFPRIlocation not on record | 2 |
| Pullman, US | 2 |
| PRClocation not on record | 2 |
| Boise, US | 2 |
| Bando, JP | 2 |
| ENTClocation not on record | 2 |
| Canadian Museum of Naturelocation not on record | 2 |
| Görlitz, DE | 2 |
| Peking Universitylocation not on record | 2 |
| 东北师范大学自然博物馆location not on record | 2 |
| Flagstaff, US | 2 |
| CJBGlocation not on record | 2 |
| Berlin, DE | 2 |
| Wellington, NZ | 2 |
| Gijón, ES | 2 |
| Millersville, US | 2 |
| San Francisco, US | 2 |
| Shanghai, CN | 2 |
| Oulu, FI | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Chiba, JP | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Bronx, US | 1 |
| STUlocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| KR | 1 |
| Moscow, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Nanchong, CN | 1 |
| Nishihara, JP | 1 |
| Trondheim, NO | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Saint Louis, US | 1 |
| Boumlocation not on record | 1 |
| Göteborg, SE | 1 |
| Tromso University Museumlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Uppsala, SE | 1 |
| Lausanne, CH | 1 |
| Tilburg, NL | 1 |
| Herb. BBGlocation not on record | 1 |
| Badajoz, ES | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Elocation not on record | 1 |
| Taipei, TW | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Xian, CN | 1 |
| Nanjing, CN | 1 |
| ULBF-AGRlocation not on record | 1 |
| Davis, US | 1 |
| TROMlocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Dresden, DE | 1 |
| Guangzhou, CN | 1 |
157 institutions · 1 905 of 2 013 vouchered records shown · 104 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Pedicularis verticillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map6 countries0
alpine Rasen uber Silikatalpine fragmentary shady grassland on silice…Common in moister areas vegetated dunes and …Moist riparian turfy tundra below camp.River bar.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.0 °C 7.40–14.1
Seasonal swing summer↔winter32.1 °C
Max temp (day)15.5 °C 9.50–18.5
Min temp (night)5.00 °C 3.00–8.80
Precipitation131 mm/mo 41.0–324
Air humidity61.7 % 57.2–64.9
Moisture balance28.0 mm/mo -54.3–236
Vapour deficit528 Pa 384–703
Wind speed3.40 m/s 2.50–4.70
Cloud cover50.8 % 35.2–71.2
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.