Pedicularis rostratocapitata

Crantz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Pedicularis

At a glance

Occurrence records5 948

Data sources9

Biological traits21

DNA specimens24

eDNA detections9

Sources9 archives

Databases and archives Pedicularis rostratocapitata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 948 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF5 948 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Pedicularis rostratocapitata is a species of flowering plant in the family Orobanchaceae commonly known as long-nosed lousewort. It is endemic to the Alps.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.095 m

⚠ sources differ — GIFT: 0.095 m · LEDA: 0.095 m · TRY: 0.073 m

Plant height generative0.125 m

Plant height max0.2 m

Plant height min0.05 m

Seed length2.36 mm

Seed mass1.09 mg

Life cycle & reproduction7

Deciduousnessevergreen

⚠ sources differ — TRY: always summer green · GIFT: deciduous

Dispersal typeself

Flowering endAug

Flowering startJul

Life spanperennial

Lifespan years8 years

Raunkiær life formVascular semi-parasite

⚠ sources differ — LEDA: Vascular semi-parasite · GIFT: hemicryptophyte

Diet & foraging1

Parasiteobligatory

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: parasitic

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis rostratocapitata has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes5

GenBank sequences3

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHG424198.1 ↗629 bpAustria

ACGT

TTGTCGAATCCTGCAAAAGCAGACCGCGAACACGTTAAACCATATTGGGACGCGGGTCTCGGGGGAACCCTTTGCCCGCGCCCATCTCTC …

Pedicularis rostratocapitata genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher A. Tribsch 111785 (SZU)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★trnL-F★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pedicularis rostratocapitata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · fl-europaea · CCDB · iapt

CCDB · fl-europaea — Mattick, 1950

CCDB · iapt — IAPT/IOPB Chromosome Data 33

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 948 records

Wild obs. + sensor5 209

Museum / vouchered604

Other135

Range

Area of Occupancy AOO5 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 1 000≤1 km 1 177≤10 km 802>10 km 12

2 991 georeferenced · 2 218 without coordinates

Open the mapobservation + sensor5 209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 45≤1 km 157≤10 km 238>10 km 1

441 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence604

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	194
GJOlocation not on record	143
BFLlocation not on record	57
LDlocation not on record	41
inatura Erlebnis Naturschau GmbHlocation not on record	24
Provincia di Livornolocation not on record	23
SZUlocation not on record	20
Bern, CH	13
Wlocation not on record	12
Mlocation not on record	11
LfUlocation not on record	10
GZUlocation not on record	7
Oskarshamn, SE	5
Herb. BBGlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
University of Salzburglocation not on record	5
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	4
Berlin, DE	4
Zürich, CH	2
BRNUlocation not on record	2
Dresden, DE	2
Frankfurt am Main	2
Moscow State Universitylocation not on record	1
Salamanca, ES	1
H-Schuhwlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Fribourg, CH	1
Görlitz, DE	1
Badajoz, ES	1
Dhaka, BD	1
Logan, US	1
Zürich, CH	1
BClocation not on record	1
CICYTEXlocation not on record	1

34 institutions · 603 of 604 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Pedicularis rostratocapitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

subalpine grassland and scrub on limestonealpine mainly calcareous open grassland and …alpine siliceous grasslandalpine grassland on limestonesubalpine to alpine grasslandsubalpine meadows and slighly ruderal places…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 6.90–15.8

Seasonal swing summer↔winter19.4 °C

Max temp (day)14.1 °C 11.1–20.1

Min temp (night)4.30 °C 1.70–9.70

Precipitation241 mm/mo 160–273

Air humidity64.9 % 63.0–66.3

Moisture balance144 mm/mo 33.8–165

Vapour deficit415 Pa 349–664

Wind speed4.20 m/s 2.80–5.50

Cloud cover36.3 % 35.5–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pedicularis rostratocapitata

At a glance

Sources9 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 948 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 948 records