Pedicularis racemosa

Douglas ex Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Pedicularis

At a glance

Occurrence records4 842

Data sources8

Biological traits12

DNA specimens8

eDNA detections6

Sources8 archives

Databases and archives Pedicularis racemosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 842 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF4 842 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf size174 mm²

Plant height0.226 m

Seed mass1.21 mg

Seed mass max1.21 mg

Seed mass min1.21 mg

Life cycle & reproduction2

Life formhemiparasitic perennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)18.85 mm²/mg

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis racemosa has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes7

GenBank sequences8

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY911248.1 ↗587 bp

ACGT

TCGAATCCTGCAAAAGCAGACCGCGAACACGTTAAACCATATTGGGACCGCGGGTCTCGGGGAGACCCTTTGCCCGCGTCCATCCCTCGC …

Pedicularis racemosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★trnL-F★ITS3★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pedicularis racemosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-fedorov

CCDB · book-fedorov — Wiens, Halleck 1962

n 83×CCDB · book-ipcn72 · CCDB · book-ipcn73-74 · CCDB · Cave1962

CCDB · book-ipcn72 — CARR, G.D. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-345.

CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I

CCDB · Cave1962 — Wiens & H. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 842 records

Wild obs. + sensor4 537

Museum / vouchered305

Origin

Native10

Range

Area of Occupancy AOO9 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 2 660≤1 km 431≤10 km 270>10 km 137

3 498 georeferenced · 1 039 without coordinates

Open the mapobservation + sensor4 537

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 9≤1 km 49≤10 km 42>10 km 2

102 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	52
Angwin, US	34
Victoria, CA	33
Albuquerque, US	25
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	24
Riverside, US	16
Flagstaff, US	16
Claremont, US	14
ASUlocation not on record	13
Logan, US	13
Vancouver, CA	11
Grand Junction, US	7
Rocky Mountain Biological Laboratorylocation not on record	6
Santa Barbara, US	5
Denver, US	4
US	3
Wlocation not on record	3
EL PASO, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Moscow State Universitylocation not on record	1
Oskarshamn, SE	1
Moscow, US	1
Pullman, US	1
San Luis Obispo, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
STUlocation not on record	1
Mexico City, MX	1
St. Paul, US	1
University of Alberta Museumslocation not on record	1
PRClocation not on record	1
University of British Columbia, Herbariumlocation not on record	1
Yellowstone National Park Herbariumlocation not on record	1

32 institutions · 297 of 305 vouchered records shown · 8 without an institution code

09Environmental DNA6 detections

Where the DNA of Pedicularis racemosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

woods on edge of marsh with geranium, abies,…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 12.6–13.4

Seasonal swing summer↔winter21.7 °C

Max temp (day)20.0 °C 19.2–20.8

Min temp (night)6.40 °C 6.00–6.80

Precipitation69.6 mm/mo 59.8–79.3

Air humidity52.9 % 48.1–57.8

Moisture balance-72.2 mm/mo -74.8–-69.5

Vapour deficit718 Pa 623–813

Wind speed3.00 m/s 2.70–3.20

Cloud cover29.0 % 25.0–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pedicularis racemosa

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 842 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 842 records