Pedicularis oederi
Vahl · speciesAt a glance
Occurrence records5 800
Data sources9
Biological traits48
DNA specimens34
eDNA detections15
Sources9 archives
Databases and archives Pedicularis oederi's data was compiled from.
GBIFGlobal Biodiversity Information Facility5 800 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotypeOn this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources48 traits
Occurrence & distributionGBIF5 800 records
Environmental DNA1 datasets · 3 countries15 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB2n = 16
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology18
Fruit length18 mm
Fruit length max18 mm
Fruit length min18 mm
Fruit width7 mm
Fruit width max7 mm
Fruit width min7 mm
Leaf length43.75 mm
Leaf length max70 mm
Leaf length min15 mm
Leaf mass12.6 mg
Leaf size230 mm²
Leaf width8 mm
Plant height0.078 m
⚠ sources differ — GIFT: 0.078 m · LEDA: 0.06 m · TRY: 0.032 m
Plant height generative0.083 m
Plant height max0.15 m
Plant height min0.03 m
Seed length2.15 mm
Seed mass0.986 mg
Life cycle & reproduction10
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: hydrochorous
Flowering endAug
Flowering startJun
Life formhemiparasitic perennial
Life spanperennial
Lifespan years3 years
Raunkiær life formVascular semi-parasite
⚠ sources differ — LEDA: Vascular semi-parasite · GIFT: hemicryptophyte
Seed number50.5
Sex typehermaphrodite
Diet & foraging1
Parasiteobligatory
Habitat & environment11
Aquaticterrestrial
Climatesubalpine or subarctic
Climberself-supporting
Elevation max5 200 m
Elevation mean4 150 m
Elevation min4 100 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTmountains, stony places, tundra
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf c444 mg/g
Leaf dry-matter content (LDMC)158 mg/g
⚠ sources differ — TRY: 158 mg/g · LEDA: 142 mg/g
Leaf n28.2 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)20.73 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationascending
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis oederi has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes8
GenBank sequences10
eDNA detections15
Countries4
The DNA barcodea real sequence read deposited for this species
TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCTCCC …
Pedicularis oederi isolate LLV53 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★trnL-F★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Pedicularis oederi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–162n range16median16mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1625×CCDB · slov-fl · CCDB · iapt · CCDB · fl-europaea +6
CCDB · slov-fl — Uhríková A. & Dúbravcová Z., 2000: Karyologické štúdium slovenskej flóry XXXI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 27-30.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · fl-europaea — Knaben, 1950
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1984. Further karyological studies of the Mongolian flora. Folia Geobot. Phytotax. 19: 28–39.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Huang, R. f., S. d. Shen & X. f. Lu. 1996. Studies of karyotype and evolution of six species in genus Pedicularis Linn. (Scrophulariaceae). Acta Bot. Boreal.-Occid. Sin. 16(1): 73–80.
CCDB · ipcn-api-dl — Huang, R. f., S. d. Shen & X. f. Lu. 1996. Studies on the chromosome number and polyploidy for a number of plants in the north-east Qinghai-Xizang Plateau. Acta Bot. Boreal.-Occid. Sin. 16(3): 310–318.
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Chromosome numbers in some species of plants of the north-eastern part of the USSR. II. (In Russian). Bot. Zhur. 52: 983-987.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1976
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-northern-plants — Knaben (unpubl.).
CCDB · book-fedorov — Knaben 1950
CCDB · book-fedorov — Mattick (T. 1950)
CCDB · book-fedorov — Hara H. 1956 ll\yxoua 1967
CCDB · iapt — IAPT/IOPB Chromosome Data 32
n 81×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 21
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 800 records
Wild obs. + sensor3 730
Museum / vouchered1 545
Cultivated / captive21
Other504
Range
Area of Occupancy AOO11 204 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 1 098≤1 km 927≤10 km 586>10 km 362
2 973 georeferenced · 757 without coordinates
Open the mapobservation + sensor3 730
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 14≤1 km 141≤10 km 167>10 km 80
402 georeferenced · 1 143 without coordinates
Open the institutions mapphysical evidence1 545
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 21 records without
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions28 of 64 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 444 |
| Moscow State Universitylocation not on record | 230 |
| LDlocation not on record | 153 |
| Uniwersytet Wrocławskilocation not on record | 111 |
| Xining, CN | 74 |
| Oskarshamn, SE | 63 |
| GMBAlocation not on record | 54 |
| GJOlocation not on record | 47 |
| Beijing, CN | 46 |
| Urumqi, CN | 41 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 23 |
| Tsukuba, JP | 16 |
| Uppsala, SE | 14 |
| BRNUlocation not on record | 13 |
| WTUlocation not on record | 11 |
| BFLlocation not on record | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| University of Stellenboschlocation not on record | 9 |
| Vancouver, CA | 8 |
| Chengdu, CN | 6 |
| Cambridge, US | 6 |
| University of Salzburglocation not on record | 5 |
| Institute of the biological problems of the North FEB RASlocation not on record | 5 |
| LfUlocation not on record | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Kunming, CN | 5 |
| Mlocation not on record | 4 |
| MeiseBGlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| SNSNMClocation not on record | 3 |
| BClocation not on record | 3 |
| Wellington, NZ | 2 |
| Kew, GB | 2 |
| Bronx, US | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Nanjing, CN | 2 |
| Frankfurt am Main | 2 |
| Bern, CH | 2 |
| Cambridge, US | 1 |
| Stockholm, SE | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Ann Arbor, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Guangzhou, CN | 1 |
| Tromso University Museumlocation not on record | 1 |
| Porvoo, FI | 1 |
| Millersville, US | 1 |
| Göteborg, SE | 1 |
| Xian, CN | 1 |
| Salzburg, AT | 1 |
| Zürich, CH | 1 |
| Wuzhou, CN | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Wlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Dehra Dun, IN | 1 |
64 institutions · 1 483 of 1 545 vouchered records shown · 62 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Pedicularis oederi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map3 countries0
alpine grassland on local limestone bedrocksteile, alpine Rasen uber basenreichem Silikatalpine fragmentary siliceous grassland and r…Gratrasen uber Karbonatgestein
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 7.80–13.3
Seasonal swing summer↔winter19.7 °C
Max temp (day)17.0 °C 11.5–17.8
Min temp (night)6.80 °C 2.90–7.60
Precipitation191 mm/mo 113–196
Air humidity62.0 % 60.1–62.6
Moisture balance78.8 mm/mo 13.4–78.9
Vapour deficit552 Pa 424–586
Wind speed2.20 m/s 2.20–6.10
Cloud cover35.5 % 35.4–54.1
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.