Pedicularis lanata

Willd. ex Cham. & Schltdl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Pedicularis

At a glance

Occurrence records1 570

Data sources11

Biological traits17

DNA specimens31

eDNA detections17

Sources11 archives

Databases and archives Pedicularis lanata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 570 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 570 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD · NCBI31 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Pedicularis lanata — вид рослин родини вовчкові (Orobanchaceae), поширений на півночі Північної Америки й Азії. Етимологія: лат. lanata — «вовнистий»

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.081 m

Plant height max0.1 m

Plant height min0.02 m

Life cycle & reproduction4

Flowering endJul

Flowering startJun

Life formhemiparasitic perennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTstony places, tundra

Mycorrhiza type0.923255417

Woodinessnon-woody

Other traits1

Shoot orientationerect

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis lanata has left across the world's sequence archives.

At a glance

DNA specimens31

Marker genes6

GenBank sequences10

eDNA detections17

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG218007.1 ↗351 bpCanada · 1995

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Pedicularis lanata voucher Gillespie_5936_CAN 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa★ITS3★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pedicularis lanata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1610×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · iapt — IAPT/IOPB Chromosome Data 5

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.

CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.

CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.

CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.

CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.

CCDB · book-ipcn67-71 — BOECHER, T.W. 1967. In IOPB chromosome number reports XI. Taxon 16: 215-222.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Chromosome numbers in some species of plants of the north-eastern part of the USSR. II. (In Russian). Bot. Zhur. 52: 983-987.

CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.

CCDB · book-fedorov — :lKyxoua 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 570 records

Wild obs. + sensor944

Museum / vouchered626

Origin

Native1

Range

Area of Occupancy AOO4 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 329≤1 km 122≤10 km 161>10 km 108

720 georeferenced · 224 without coordinates

Open the mapobservation + sensor944

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 6≤1 km 14≤10 km 19>10 km 15

54 georeferenced · 572 without coordinates

Open the institutions mapphysical evidence626

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	292
University of Stellenboschlocation not on record	42
Moscow State Universitylocation not on record	37
Anchorage, US	28
Vancouver, CA	24
Yukon Universitylocation not on record	20
WTUlocation not on record	20
Victoria, CA	16
Chongqing Museumlocation not on record	14
Québec, CA	12
Olocation not on record	12
Canadian Museum of Naturelocation not on record	11
Bronx, US	7
St. Paul, US	7
Whitehorse, CA	7
Wuzhou, CN	6
Oulu, FI	6
Trois-Rivières, CA	5
Tempe, US	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
TROMlocation not on record	3
Edinburgh, GB	3
Paris, FR	2
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	2
Flagstaff, US	2
MeiseBGlocation not on record	2
Orem, US	2
Frankfurt am Main	1
Walla Walla, US	1
Université Lavallocation not on record	1
Montréal, CA	1
Portland, US	1
Los Angeles, US	1
Acadia Universitylocation not on record	1
Dekalb, US	1
Moscow, US	1
Williamsburg, US	1
Saint Louis, US	1
GB	1
Cambridge, US	1
West Virginia Wesleyan Collegelocation not on record	1
GINRlocation not on record	1
Trondheim, NO	1
Tacoma, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Copenhagen, DK	1
GJOlocation not on record	1
Uppsala, SE	1
Tromso University Museumlocation not on record	1

49 institutions · 611 of 626 vouchered records shown · 15 without an institution code

09Environmental DNA17 detections

Where the DNA of Pedicularis lanata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

Open HorsetailHygric Meadow (or Hydric Meadow)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 3.90–10.9

Seasonal swing summer↔winter37.0 °C

Max temp (day)12.7 °C 6.50–15.0

Min temp (night)6.40 °C 1.20–6.90

Precipitation46.1 mm/mo 25.3–86.0

Air humidity61.0 % 57.0–65.5

Moisture balance-10.6 mm/mo

Vapour deficit484 Pa 296–556

Wind speed4.40 m/s

Cloud cover66.6 % 46.9–73.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pedicularis lanata

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 570 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 49 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 570 records