Pedicularis flammea

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Pedicularis

At a glance

Occurrence records2 754

Data sources10

Biological traits14

DNA specimens38

eDNA detections18

Sources10 archives

Databases and archives Pedicularis flammea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 754 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF2 754 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD · NCBI38 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Pedicularis flammea, la pédiculaire flammée, est une espèce de plantes à fleurs de la famille des Scrophulariaceae selon la classification classique de Cronquist (1981) ou des Orobanchaceae selon la classification phylogénétique. C'est une plante herbacée que l'on trouve en Amérique du Nord, au Groenland, en Islande et dans les Alpes scandinaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.05 m

Life cycle & reproduction3

Life formhemiparasitic perennial

Life spanperennial

Lifespan years5 years

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf c409 mg/g

Leaf n23.45 mg/g

Specific leaf area (SLA)12.95 mm²/mg

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis flammea has left across the world's sequence archives.

At a glance

DNA specimens38

Marker genes6

GenBank sequences10

eDNA detections18

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT960313.1 ↗352 bpGreenland · 2012

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Pedicularis flammea voucher ZA2012-2532 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pedicularis flammea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records8–162n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +1

CCDB · fl-europaea — Dove & L'ove, 1956

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · ipcn-api-dl — Dalgaard, V. 1988. Chromosome numbers in some vascular plants from the Disko Bugt area (west Greenland). Willdenowia 18: 243–252.

CCDB · book-atlas-flowering-plants — L. & L. 1948

CCDB · Cave1956 — Love & Love b

2n 81×CCDB · Cave1958

CCDB · Cave1958 — Jorgensen et al. 1958

n 81×CCDB · Cave1958

CCDB · Cave1958 — Jorgensen et al. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 754 records

Wild obs. + sensor1 529

Museum / vouchered1 220

Other5

Range

Area of Occupancy AOO5 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 589≤1 km 90≤10 km 49>10 km 14

742 georeferenced · 787 without coordinates

Open the mapobservation + sensor1 529

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 56≤1 km 74≤10 km 206>10 km 30

366 georeferenced · 854 without coordinates

Open the institutions mapphysical evidence1 220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	428
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	167
TROMlocation not on record	117
Garðabær, IS	76
Québec, CA	69
	44
University of Alberta Museumslocation not on record	43
Trondheim, NO	40
LDlocation not on record	38
Toronto, CA	19
Montréal, CA	18
Chongqing Museumlocation not on record	14
Montréal, CA	13
Université Lavallocation not on record	12
WINlocation not on record	10
Acadia Universitylocation not on record	9
Oskarshamn, SE	8
Bronx, US	7
University of Stellenboschlocation not on record	7
Uppsala, SE	7
Memorial University of Newfoundlandlocation not on record	5
Canadian Museum of Naturelocation not on record	5
Moscow State Universitylocation not on record	4
Churchill Northern Studies Centrelocation not on record	4
SLU Artdatabankenlocation not on record	4
Bergen, NO	3
University of Helsinkilocation not on record	3
Wuzhou, CN	2
Edinburgh, GB	2
Uniwersytet Śląski w Katowicachlocation not on record	2
St. Paul, US	2
Copenhagen, DK	2
KMNlocation not on record	2
Staten Island, US	1
GJOlocation not on record	1
Victoria, CA	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Dresden, DE	1
Dekalb, US	1
Trois-Rivières, CA	1
SNSNMClocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Umeå Universitylocation not on record	1
Whitehorse, CA	1
Tromso University Museumlocation not on record	1
West Virginia Wesleyan Collegelocation not on record	1
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1

47 institutions · 1 200 of 1 220 vouchered records shown · 20 without an institution code

09Environmental DNA18 detections

Where the DNA of Pedicularis flammea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

Sedge - Saalix arctophila Fen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C 1.90–11.5

Seasonal swing summer↔winter33.3 °C

Max temp (day)9.30 °C 2.90–14.7

Min temp (night)3.50 °C -0.6–7.70

Precipitation62.1 mm/mo 27.8–92.2

Air humidity62.2 % 55.2–69.4

Moisture balance-15.7 mm/mo

Vapour deficit360 Pa 221–524

Wind speed3.40 m/s

Cloud cover45.9 % 39.0–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pedicularis flammea

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 754 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 47 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 754 records