Pedicularis densiflora

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Pedicularis

At a glance

Occurrence records11 946

Data sources8

Biological traits12

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Pedicularis densiflora's data was compiled from.

GBIFGlobal Biodiversity Information Facility11 946 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF11 946 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.08 mg

⚠ sources differ — TRY: 3.08 mg · GIFT: 3.38 mg

Seed mass max6.06 mg

Seed mass min0.7 mg

Life cycle & reproduction2

Life formhemiparasitic perennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedicularis densiflora has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ735491.1 ↗612 bpUSA

ACGT

GAATCCTGCAAAAGCGGACCGCGAACACGTTAAACCACATTGGGATCGCGGGTGTTGTGGGTGACGCTTTGCCCGCGCCCAACTCTCGCA …

Pedicularis densiflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pedicularis densiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 83×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Chuang, T. I. & L. R. Heckard. 1992. Chromosome numbers of some North American Scrophulariaceae, mostly Californian. Madroño 39(2): 137–149.

CCDB · book-ipcn72 — CARR, G.D. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-345.

CCDB · book-ipcn67-71 — SPELLENBERG, R. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 946 records

Wild obs. + sensor11 794

Museum / vouchered152

Range

Area of Occupancy AOO8 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 7 390≤1 km 1 158≤10 km 627>10 km 373

9 548 georeferenced · 2 246 without coordinates

Open the mapobservation + sensor11 794

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 15≤1 km 64≤10 km 33>10 km 2

114 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	55
San Luis Obispo, US	32
Bloomington, US	6
University of Stellenboschlocation not on record	6
Chongqing Museumlocation not on record	5
San Diego, US	4
Santa Cruz, US	4
ASUlocation not on record	4
EL PASO, US	3
Mexico City, MX	3
Logan, US	2
Austin, US	2
Long Beach, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Bangkok, TH	2
Pullman, US	2
Bronx, US	2
Flagstaff, US	2
Davenport, US	2
Mexico City, MX	1
Riverside, US	1
Claremont, US	1
Phoenix, US	1
Vancouver, CA	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Saint Louis, US	1
Beijing, CN	1
San Jose, US	1
Brookings, US	1
Wuzhou, CN	1
Macomb, US	1

31 institutions · 152 of 152 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Pedicularis densiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Senecio gande, Monardella sp.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter10.2 °C

Max temp (day)22.1 °C

Min temp (night)12.2 °C

Precipitation5.80 mm/mo

Air humidity61.9 %

Moisture balance-134 mm/mo

Vapour deficit729 Pa

Wind speed1.50 m/s

Cloud cover25.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pedicularis densiflora

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 946 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions26 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 946 records