Pedalium murex

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Pedaliaceae/Pedalium

At a glance

Occurrence records517

Data sources12

Biological traits17

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Pedalium murex's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS52 compounds

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Pedalium is a genus of plant in the Pedaliaceae family comprising one species, Pedalium murex. It is distributed in India, Sri Lanka and Tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · TRY: 0.435 m

Seed mass190 mg

Seed mass max190 mg

Seed mass min190 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTsaline soil indicator in sand or on limestone in short gras near the coast, also in sisal plantations

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition52 compounds

Compounds documented for Pedalium murex across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones7

Cycloartane triterpenoids4

Hydroxy fatty acids $ Unsaturated fatty acids3

Hydrocarbons3

Furofuranoid lignans2

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1R,2S,3'R,4R,6S,8R,9R,10R,12S,15R,20S,21R,23S)-21-hydroxy-2,3',8,10,19,19-hexamethylspiro[5,13,14,18-tetraoxahexacyclo[18.3.2.02,10.04,9.012,23.015,21]pentacosane-6,5'-oxolane]-2',17-dione	present	NPASS
(1R,3'R,4R,5R,6R,8S,10R,12S,13S,16R,21R,25R)-25-hydroxy-3',4,6,12,17,17-hexamethylspiro[9,18,22,23-tetraoxahexacyclo[14.7.2.01,13.04,12.05,10.021,25]pentacosane-8,5'-oxolane]-2',19-dione	present	NPASS
(1S,3'R,4R,5R,6R,8S,10R,12S,13S,16S,22S)-3',4,6,12,17,17-hexamethylspiro[9,18,23,24-tetraoxahexacyclo[20.2.1.01,13.04,12.05,10.016,22]pentacos-20-ene-8,5'-oxolane]-2',19-dione	present	NPASS
(4aS,6aR,6aR,6bR,7R,8aR,10S,12aS,14bS)-7,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
6-Methylscutellarein	present	LOTUS
AOUGNCPHJBSCDC-WUUBZBNVSA-N	present	NPASS
beta-Sitosterol	present	LOTUS
BLWMRHVRTCANOX-CNKWFCIJSA-N	present	NPASS
CRGMIRPYRQVNGC-WUUBZBNVSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pedalium murex has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK792323.1 ↗328 bpIndia · 2017

ACGT

GACCGCGAACACGTAACTAACAACCCTGGGGTCGTGGCGTGGGCGGAAGCCCCCCTGTCTCGGCCCCTCCCCCCGCCGGTGCGCGCGCGA …

Pedalium murex isolate MA3 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★rbcLa★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pedalium murex carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Sriniv11san 1942

CCDB · book-atlas-flowering-plants — Srinivasan 1942

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type517 records

Wild obs. + sensor388

Museum / vouchered125

Other4

Range

Area of Occupancy AOO1 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 140≤1 km 53≤10 km 38>10 km 12

243 georeferenced · 145 without coordinates

Open the mapobservation + sensor388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤1 km 26≤10 km 2>10 km 1

29 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	20
Kew, GB	19
HNBlocation not on record	10
Saint Louis, US	10
Pondicherry, IN	9
Paris, FR	8
Berlin, DE	6
MeiseBGlocation not on record	5
Instituto de Investigação Científica Tropicallocation not on record	4
Uppsala, SE	4
Wlocation not on record	3
Université du Lomélocation not on record	3
CNF-UFHBlocation not on record	2
Frankfurt am Main	2
Gujarat Biodiversity Gene Banklocation not on record	2
Plocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1

17 institutions · 109 of 125 vouchered records shown · 16 without an institution code

09Environmental DNA3 detections

Where the DNA of Pedalium murex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

GardenA weed in gardens and cultivated fields. us…Coastal Area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.5 °C 28.5–28.5

Seasonal swing summer↔winter11.3 °C

Max temp (day)31.3 °C 31.1–31.4

Min temp (night)25.1 °C

Precipitation130 mm/mo 54.0–205

Air humidity58.7 % 54.6–62.8

Moisture balance-18.4 mm/mo -95.0–58.3

Vapour deficit1,604 Pa 1,444–1,764

Wind speed3.00 m/s 2.40–3.50

Cloud cover11.8 % 5.50–18.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)